How to fix mix-orientation reads

I've been searching the answers in Q2 forum, some clues but still have low confidence that how to fix this issue.

Hiseq 250bp data, paired-end. I think that there are forward and reverse reads in both R1 and R2. I think it would be best is to have the files in the same orientation in each file, but have no idea how to do that by Q2.

Example. Primer VH1_2 (AGGTCCAACTGCAGCAGCC) can be found starting at position 2 in R1 or R2.

One pair where it matches R1.

R1:

@SNL147:722:HGCMVBCXY:2:1106:18591:4974

CAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGATGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAATCAGAGGCCTGGACGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAA

GTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCGCCAGCACAGCCTACATGCAGCTCC

R2:

@SNL147:722:HGCMVBCXY:2:1106:18591:4974

GAGGAAACGGTGACCGTGGTCCCTGTGCCCCAGACATCGAAGTACCAAACCCCGTCCCAGTTTGATCTTGCACAATAATAGACCGCAGAGTCCTCAGATGTCAGGCTGCTGAGCTGCATGTAGGCTGGGCTGGAGGGGTTGTCTACAGTCAGTGTGGCCTTGCTCTTTGACTTCTC

ATTTTACTTAGTACCACCAATATTAGGATCAATCCATCCAATCCACTCAAGGCCTCGCCCAGGCCGCCGCTTCA

One pair where it matches R2:

R1:

@SNL147:722:HGCMVBCXY:2:1106:7141:4616

CAGGTTCAGGTGACCGTGGTCCCTGTGCCCCAGACATCGAAGTACCAGCTCTACTACCGTAGTCCCCTTGCACAATAATAGACCGCAGAGTCCTCAGATGTCAGGCTGCTGAGTTGCATGTAGGCTGTGCTGGAGGATTTGTCTGCAGTCAGTGTGGCCTTGCCCTTGAACTTCCC

ATTGTAGTTAGTATAACTATCAGAAGGATCAATCTCTCCAATCCACTCAAGGCCATGTCAAGGCCTCTGCTTTG

R2:

@SNL147:722:HGCMVBCXY:2:1106:7141:4616

CAGGTCCAACTGCAGCAGCCTGGGGCTGGACTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGATACACCTTCACTAACTACTGGATAGGTTGGGCAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTGATCCTTCTGATAGTTATACTAA

CTACAATGGGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACGCC

Hey @mimisikai - we have added support for this in the upcoming QIIME 2 2020.6 release, currently scheduled for public release tomorrow. If you want to test it out (using a pre-release version) see the install instructions here:

https://dev.qiime2.org/latest/quickstart/


changelog:

Thanks, @thermokarst. Are you pointing cutadapt function? My data has been de-multiplexed. Is that also working so? And could you tell where I can find tutorial about that? Thanks.

Yes, sorry for not making that clear.

Ah, unfortunately this won't help you. Can you get your hands on the multiplexed reads?

There is no tutorial at present.

Hi @thermokarst, It seems rawest data they can provide. I wonder QIMME2 must handle sequence with multiplexed reads? I don't want to cut any sequence in my read if they're already demultiplexed. I only need to orientate them to make sure they're all in the same direction. Because in the next step I need to annotate the sequence based on the For and Rev primers.

I'm pretty sure I saw a thread in the forum said R1+R2 --> new R1, and R2+ R1 --> new R2, then somehow input newR1 and new R2 into Q2 for processing should be fix out this problem. I try to find this post but I cannot.

In general, no - but in this case, if you had multiplexed reads, you could use the new mixed-orientation demux in q2-cutadapt 2020.6.

If you can get the multiplexed reads (or somehow make them by concatenating reads together), you could use q2-cutadapt.