I am new to qiime2 so pardon me if my terminology is off. I am trying to integrate my data into the pipeline to generate OTUs for a set of nanopore data. The data that I have looks like this:
I5_8_I7_9.1 bc=TGTTCCGTCGGCTAAT
TGTT…[more sequence]…TGACT
I5_8_I7_9.2 bc=TGTTCCGTCGGCTAAT
TGTT…[more sequence]…CGTT
Where each line is a sequence from a single barcode mapped back to a given sample (called I5_8_I7_9). I have a total of 24 samples mapped. I created a map file that looks like this:
|#SampleID|BarcodeSequence|LinkerPrimerSequence|Subject|Edge 50m|Edge 100m|Year|Age|Sex|
|#q2:types|categorical|categorical|categorical|Categorical|Categorical|numeric|categorical|categorical|
|I5_8_I7_9|TGTTCCGTCGGCTAAT|CACTCTTTCCCTACACGACGCTCTTCCGATC|CF2001|E|E|2015|Adult|Female|
etc…
I have hit a road block. I have no idea how I take this data and use Qiime to call OTUs for each of my samples. I have read the tutorials, but they all start at the fastq file and go through deblur and denoise which is not what I have right now. I have been using the qiime 2 studio and also the command line but have only gotten so far as to import my sequence file into a FeatureData[Sequence]. Please help!