Hi,
I am new to using QIMME but have run into difficulties in generating a Features Table. I have unaligned sequences in FASTA format as follows:
J2955S10L001R1001_0000001
GCTTCTCATCTCAAACCCGCGCCACCTGGGGCACCCGATGAGTCCTGGGAACTGGAAAAG
J2955S10L001R1001_0000002
GCTTCTCATCTCAAACCCGCGCCACCTGGGGTACCCGATGAGTCCTGGGAACTGGAAAAG
Where the the header is in the format _
I can import these sequences as a FeatureData[sequence] but not as a SampleData[sequences] file. As such I cannot run “qiime vsearch dereplicate-sequences” or “qiime vsearch cluster-features-de-novo”.
I simply want to generate a Features table and a fasta file containing representative sequences. Is there a way I can do this with the FeatureData[sequence] data type? Alternatively, is there a way to coerce this data into a SampleData[sequences] file format? I saw another post with a similar problem from earlier this year but no solution was offered.
Thank you for any help.