Feature table from only FeatureData[sequence]

Hi,

I am new to using QIMME but have run into difficulties in generating a Features Table. I have unaligned sequences in FASTA format as follows:

J2955S10L001R1001_0000001
GCTTCTCATCTCAAACCCGCGCCACCTGGGGCACCCGATGAGTCCTGGGAACTGGAAAAG
J2955S10L001R1001_0000002
GCTTCTCATCTCAAACCCGCGCCACCTGGGGTACCCGATGAGTCCTGGGAACTGGAAAAG

Where the the header is in the format _

I can import these sequences as a FeatureData[sequence] but not as a SampleData[sequences] file. As such I cannot run “qiime vsearch dereplicate-sequences” or “qiime vsearch cluster-features-de-novo”.

I simply want to generate a Features table and a fasta file containing representative sequences. Is there a way I can do this with the FeatureData[sequence] data type? Alternatively, is there a way to coerce this data into a SampleData[sequences] file format? I saw another post with a similar problem from earlier this year but no solution was offered.

Thank you for any help.

Really? That surprises me, since this looks like the QIIME 1 Demux Format to me. Did you try something like this?

qiime tools import \
  --input-path seqs.fna \
  --output-path seqs.qza \
  --type 'SampleData[Sequences]'

Please post the exact command you ran, and the exact error you received. Thanks!

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.