Feature-classifier classify-sklearn

Hi I ran the following commands, and I couldn't get to run the last 2 commands without # next to it

I ran :module add chpc/python/anaconda/3
source activate qiime2-2018.6
#qiime tools import
--type FeatureData[Sequence]
--input-path sh_refs_qiime_ver7_dynamic_01.12.2017.fasta
--output-path unite-ver7-01.12.2017.qza

#qiime tools import
--type FeatureData[Taxonomy]
--input-path sh_taxonomy_qiime_ver7_dynamic_01.12.2017.txt
--output-path unite-ver7-tax_01.12.2017.qza
--source-format HeaderlessTSVTaxonomyFormat

#qiime feature-classifier extract-reads
--i-sequences unite-ver7-01.12.2017.qza
--p-f-primer TCCGTAGGTGAACCTGCGG
--p-r-primer TCCTCCGCTTATTGATATGC
--p-trunc-len 100
--o-reads ref-seqs.qza

qiime feature-classifier classify-sklearn /
--i-classifier ref-seqs.qza
--i-reads unite-ver7-tax_01.12.2017.qza
--o-classification unite-ver7-dynamic-classifier-01.12.2017.qza

qiime tools import
--type 'SampleData[SequencesWithQuality]'
--input-path casava-18-paired-end-demultiplexed \
--source-format CasavaOneEightSingleLanePerSampleDirFmt
--output-dir demux-single-end.qza

This is the error I got
var/spool/PBS/mom_priv/jobs/1456395.sched01.SC: line 17: --type: command not found
/var/spool/PBS/mom_priv/jobs/1456395.sched01.SC: line 22: --type: command not found
/var/spool/PBS/mom_priv/jobs/1456395.sched01.SC: line 28: --i-sequences: command not found
Usage: qiime feature-classifier classify-sklearn [OPTIONS]

Error: Got unexpected extra argument (/)
/var/spool/PBS/mom_priv/jobs/1456395.sched01.SC: line 35: --i-classifier: command not found
/var/spool/PBS/mom_priv/jobs/1456395.sched01.SC: line 36: --i-reads: command not found
/var/spool/PBS/mom_priv/jobs/1456395.sched01.SC: line 37: --o-classification: command not found
Usage: qiime tools import [OPTIONS]

Error: Missing option "--output-path".
/var/spool/PBS/mom_priv/jobs/1456395.sched01.SC: line 42: --source-format: command not found

Hey @kedi!

The issue is the newline escaping, whenever you wrap a single command over multiple lines you have to end the intermediate lines with \. Only the very last line should not have \ at the end.

In a bunch of commands it looks like this is missing, there's also one where you use / instead of \, which won't work either.

Whenever you see --some-kind-of-option: command not found that is almost certainly what is going on.

Hope the gets you on your way!

Hi @ebolyen, thanks very much !