hi while running the following command: qiime feature-classifier extract-reads --i-sequences 99_otus.qza --p-f-primer TATGGTAATTCAATTACCGCGGCTGCTGG --p-r-primer AGTCAGTCAGCCGAGTTTGATCMTGGCTCAG --p-min-length 450 --p-max-length 490 --o-reads ref-seqs.qza i am getting an error of "0 matc…

Welcome to the forum, @Nisha ! You are not getting matches, because you are including some portion of the non-biological adapter sequence in your primer sequences. See this similar topic for more details: [image] Plugin error: feature-classifier User Support Hi @Cheng50373…

thanks for your response. actually I took this primer sequences from a paper for v1-v3 region. and there they clearly showed adapter, barcode and primer sequences. so i used that as my primer.

[image] Nisha: actually I took this primer sequences from a paper for v1-v3 region. and there they clearly showed adapter, barcode and primer sequences. so i used that as my primer. I recommend looking up a different source, because the primers you posted are longer than the normal V1 and V3 …

QIIME 2 Forum

error in extraction of reference reads

Technical Support

show post in topic

Home
Categories
Guidelines
Terms of Service
Privacy Policy

Powered by Discourse, best viewed with JavaScript enabled