error in extraction of reference reads

[Nisha]

hi
while running the following command:
qiime feature-classifier extract-reads
–i-sequences 99_otus.qza
–p-f-primer TATGGTAATTCAATTACCGCGGCTGCTGG
–p-r-primer AGTCAGTCAGCCGAGTTTGATCMTGGCTCAG
–p-min-length 450
–p-max-length 490
–o-reads ref-seqs.qza
i am getting an error of “0 matchs found”

[Nicholas_Bokulich]

Welcome to the forum, @Nisha!

You are not getting matches, because you are including some portion of the non-biological adapter sequence in your primer sequences. See this similar topic for more details:

Plugin error: feature-classifier

Hi @Cheng50373640, It looks like the primers you are inputting are the full tailed PCR primers provided in, e.g., Nextera kits. These primer sequences contain Illumina adapter sequences on the 5’ end that do not anneal to target DNA, and do not match any known sequences in nature (they are designed this way to avoid amplification bias and other issues). Hence, the 5’ portion of these sequences will not match any sequences in Greengenes, resulting in a lack of hits. What you need to provide to e…

Good luck!

[Nisha]

thanks for your response.
actually I took this primer sequences from a paper for v1-v3 region. and there they clearly showed adapter, barcode and primer sequences. so i used that as my primer.

[Nicholas_Bokulich]

@Nisha

actually I took this primer sequences from a paper for v1-v3 region. and there they clearly showed adapter, barcode and primer sequences. so i used that as my primer.

I recommend looking up a different source, because the primers you posted are longer than the normal V1 and V3 primers, though the primer sequences are contained in there. I'm finding this paper which shows the actual primer seqs in italics. Use those seqs instead.

Good luck!