error in extraction of reference reads

hi
while running the following command:
qiime feature-classifier extract-reads
–i-sequences 99_otus.qza
–p-f-primer TATGGTAATTCAATTACCGCGGCTGCTGG
–p-r-primer AGTCAGTCAGCCGAGTTTGATCMTGGCTCAG
–p-min-length 450
–p-max-length 490
–o-reads ref-seqs.qza
i am getting an error of “0 matchs found”

Welcome to the forum, @Nisha!

You are not getting matches, because you are including some portion of the non-biological adapter sequence in your primer sequences. See this similar topic for more details:

Good luck!

thanks for your response.
actually I took this primer sequences from a paper for v1-v3 region. and there they clearly showed adapter, barcode and primer sequences. so i used that as my primer.

I recommend looking up a different source, because the primers you posted are longer than the normal V1 and V3 primers, though the primer sequences are contained in there. I’m finding this paper which shows the actual primer seqs in italics. Use those seqs instead.

Good luck!

1 Like

A post was split to a new topic: ANCOM tutorial — do I need to filter my table?