Error feature-classifier extract-reads


(Dimitrios Kioroglou) #1

Hello,

I’m using the version 2018.11.0 of qiime2, installed with conda, and I tried to extract reads, for training purposes, with the plugin “feature-classifier” from the Silva 16S database v132.

Before writting all the steps I went into, I would like to ask you whether it makes sense to get the following error

RuntimeError: No matches found

when I’m using the following primers for extracting reads for the 16S V3-V4 region:

forward primer: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG
reverse primer: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC

whereas I do not get any error when I’m trying to extract reads with the following primers:

forward primer: GTGCCAGCMGCCGCGGTAA
reverse primer: GGACTACHVHHHTWTCTAAT

The error has also been replicated by using an older qiime2 version (2018.2.0) and also after lowering the parameter “–p-identity” to 0.7.

The first primers have been used successfully in Illumina MiSeq 16S sequencing.

Thanks in advance for any help.


(Nicholas Bokulich) #2

Hi @DKioroglou,
Please see this topic for a solution:

Good luck!


(Dimitrios Kioroglou) #3

Thank you for your quick response.
I would like to verify that the solution you gave on that post worked.

I searched onlined and I found this PDF from Illumina support that confirms your answer. Perhaps I should have searched for it before but it didn’t cross my mind that adapters and linkers are included.

Based on that PDF the primers are like the following:

Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus‐specific sequence]
Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐specific sequence]

Therefore, as you have also said in your solution, the primers that should be used to extract reads are the ones in bold:

forward primer: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG
reverse primer: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC