Dereplicated problem

[joe (jose antonio)]

hello I'm new using qiime2 so I expect you can help me to solve this issue:
I've imported a format fasta with 154 sequences these are the header characteristic:

Seq1_access-EU048402
CCTACTGGCCGCCGCAGTACACGTTCATGGACGGCGATACGCTTGAACCGCTGAAGA
Seq2_access-EU048403
CCTACTGGCCGCCGCAGTACACGTTCATGGACGGCGATACGCTTGAACCGCTGAAGA
I imported with this code:
qiime tools import --input-path seqs.fasta --output-path seqs.qza --type 'SampleData[Sequences]'

qiime2 gave me
Imported seqs.fasta as QIIME1DemuxDirFmt to seqs.qza

And now, I'm trying to dereplicate with this code
qiime vsearch dereplicate-sequences --i-sequences seqs.qza \ --o-dereplicated-table table.qza \ --o-dereplicated-sequences rep-seqs.qza

but qiime gave me this error:
Plugin error from vsearch:
list index out of range

how can I solve that?

[Nicholas_Bokulich]

Welcome to the forum @joe!

What version of QIIME 2 are you running?

This is probably a line ending or other formatting issue in your FASTA file, see these topics for examples:

Vsearch dereplicate seqs - list index out of range

Hello qiime2 users and team, I am relatively new to this programme and after going through the main tutorials I tried to use qiime2 (2018.8) to import a big FASTA and create a feature table with vsearch dereplicate (since, as far as I know, dada2 and deblur are not an option for a FASTA without quality). All good importing the file, but when I tried to dereplicate I incurred in this error which I don’t know how to interpret: IndexError: list index out of range - I searched for similar error in…

qiime vsearch dereplicate-sequences error "list index out of range"

I am using conda install of Qiime2-2019.4 on a Ubuntu 18.04 machine with 192GB of RAM. I have a FASTA file that is in Qiime1 seqs.fna format. I can import the seqs.fna file as sampledata with no problems. When I try to dereplicate the data vsearch returns a “list index out of range” error. My sample ids do not contain special characters. ##Here is the output: Command: vsearch --derep_fulllength /tmp/qiime2-archive-y50m_wa7/09772ffd-65f4-47d5-9a34-1e70bf14a5d1/data/seqs.fna --output /tmp/q2…

I hope that helps!