hello I’m new using qiime2 so I expect you can help me to solve this issue:
I’ve imported a format fasta with 154 sequences these are the header characteristic:
Seq1_access-EU048402
CCTACTGGCCGCCGCAGTACACGTTCATGGACGGCGATACGCTTGAACCGCTGAAGA
Seq2_access-EU048403
CCTACTGGCCGCCGCAGTACACGTTCATGGACGGCGATACGCTTGAACCGCTGAAGA
I imported with this code:
qiime tools import --input-path seqs.fasta --output-path seqs.qza --type ‘SampleData[Sequences]’
qiime2 gave me
Imported seqs.fasta as QIIME1DemuxDirFmt to seqs.qza
And now, I’m trying to dereplicate with this code
qiime vsearch dereplicate-sequences --i-sequences seqs.qza \ --o-dereplicated-table table.qza \ --o-dereplicated-sequences rep-seqs.qza
but qiime gave me this error:
Plugin error from vsearch:
list index out of range