Dereplicated problem

hello I’m new using qiime2 so I expect you can help me to solve this issue:
I’ve imported a format fasta with 154 sequences these are the header characteristic:

Seq1_access-EU048402
CCTACTGGCCGCCGCAGTACACGTTCATGGACGGCGATACGCTTGAACCGCTGAAGA
Seq2_access-EU048403
CCTACTGGCCGCCGCAGTACACGTTCATGGACGGCGATACGCTTGAACCGCTGAAGA
I imported with this code:
qiime tools import --input-path seqs.fasta --output-path seqs.qza --type ‘SampleData[Sequences]’

qiime2 gave me
Imported seqs.fasta as QIIME1DemuxDirFmt to seqs.qza

And now, I’m trying to dereplicate with this code
qiime vsearch dereplicate-sequences --i-sequences seqs.qza \ --o-dereplicated-table table.qza \ --o-dereplicated-sequences rep-seqs.qza

but qiime gave me this error:
Plugin error from vsearch:
list index out of range

how can I solve that?

Welcome to the forum @joe!

What version of QIIME 2 are you running?

This is probably a line ending or other formatting issue in your FASTA file, see these topics for examples:


I hope that helps!

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.