denoising steps

Hi everyone,
I imported my data and you can see the quality scores in the below picture:


I think the quality scores are good enough to proceed without using CUTADAPT plugin (please let me know if I'm wrong), so I used DADA2 but the stats doesn't make sense:
.
I'm not sure what's the problem. could you please let me know how can I fix this?
also, I'm not sure but maybe this problem is due to the adapters are still exist.
could you please let me know what is the problem with this stats?
thank you

Hi @mohsen_ej,

I've re-categorized your question from Technical Support to User Support, since you are asking about the interpretation of your results, rather than a specific error message you are receiving.

Friendly reminder to please include the following details so that we can assist you:

  • Version of QIIME 2 you are running, and how it is installed (e.g. Virtualbox, conda, etc.)
  • What is the exact command or commands you ran? Copy and paste please.
  • What are you seeing in the results table that concerns you? The number of chimeric sequences?

Cheers,
Liz

3 Likes

Thank you for your response. and sorry for my unclear question.
I'm using qiime2 V 2021.2 on virtual machine.
I used this command to remove the primers:
qiime cutadapt trim-paired \

-- i- *demultiplexed-sequences paired-end-demux.qza *

--p-front-f CCTACGGGNGGCWGCAG **

--p-front-r GACTACHVGGGTATCTAATCC **

*--p-match-adapter-wildcards *

*--p-match-read-wildcards *

--o-trimmed-sequences paired-end-demux-trimmed.qza
but nothing has been done for adapters if it is necessary to do.
and then used this comma qiime dada2 denoise-paired **

--i-demultiplexed-seqs *paired-end-demux-trimmed.qza\

--p-trim-left-f 0 \

--p-trim-left-r 0 \

--p-trunc-len-f 232 \

--p-trunc-len-r 232 \

--o-table table.qza \

--o-representative-sequences rep-seqs.qza \

--o-denoising-stats denoising-stats.qza

exactly the chimeric sequences concern me. since some one else got the below result:


I'm not sure what can be the difference in our commands which concluded different results. I cannot access that person to ask him about the command he run :sweat_smile:
the primers and adapters are as below:
The forward primer was constructed with the Illumina 5' overhang adapter sequence (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG) followed by the forward primer sequence (CCTACGGGNGGCWGCAG). The reverse primer was constructed with another 5' overhang adapter sequence (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) and followed by the reverse primer sequence (GACTACHVGGGTATCTAATCC).
thank you very much in advance

Hi @mohsen_ej,

Thanks for providing those details! What I suspect is happening (based on your above commands for cutadapt trim-paired) is that many of your actual sequences are being removed unintentionally, due to the formatting of your --p-front-r and --p-front-f inputs. You may want to anchor the sequences you've included in those commands, to ensure that those are only being interpreted and removed at the beginning and end of your reads. More information on anchoring can be found in the cutadapt docs, linked here. Hope this helps!

Cheers :lizard: