Hi there,
I'm trying to demux my 16s fastq file but I've run to this error:
"Plugin error from demux:
Mismatched sequence descriptions: 1 length=12, 1 length=151, and 1 length=151
Debug info has been saved to /tmp/qiime2-q2cli-err-1q1gu376.log"
that I cannot figure out how to solve, isn't the barcode file supposed to be a different length?
I appreciate the help in advance,
best,
Anna
Hello @Anahid_Amani_Moghada, can you please rerun your command with the --verbose flag and post both the command you ran and the entire output here? Thank you.
sure,
This is my command:
module purge all
module load qiime2/2021.2
qiime demux emp-paired
--m-barcodes-file barcodes.tsv
--m-barcodes-column BarcodeSequence
--verbose
--i-seqs mux.qza
--o-per-sample-sequences demux-full.qza
--o-error-correction-details demux-details.qza
and here is the error:
Traceback (most recent call last):
File "/opt/conda/envs/qiime2-2021.2/lib/python3.6/site-packages/q2cli/commands.py", line 329, in call
results = action(**arguments)
File "", line 2, in emp_paired
File "/opt/conda/envs/qiime2-2021.2/lib/python3.6/site-packages/qiime2/sdk/action.py", line 245, in bound_callable
output_types, provenance)
File "/opt/conda/envs/qiime2-2021.2/lib/python3.6/site-packages/qiime2/sdk/action.py", line 390, in callable_executor
output_views = self._callable(**view_args)
File "/opt/conda/envs/qiime2-2021.2/lib/python3.6/site-packages/q2_demux/_demux.py", line 399, in emp_paired
for i, record in enumerate(seqs, start=1):
File "/opt/conda/envs/qiime2-2021.2/lib/python3.6/site-packages/q2_demux/_demux.py", line 238, in iter
_trim_description(reverse_header.description)))
ValueError: Mismatched sequence descriptions: 1 length=12, 1 length=151, and 1 length=151
Plugin error from demux:
Mismatched sequence descriptions: 1 length=12, 1 length=151, and 1 length=151
See above for debug info.
Hello @Anahid_Amani_Moghada,
Is your data in EMP Protocol Format? If you aren't sure, can you run the head command on one of your fastq files and on your barcodes file and post the results here. Aalternatively, if you aren't sure how to do that, can you DM me one of your fastq files and your barcodes file. If I can look at your fastq headers I can tell you whether they follow EMP Protocol or not.
Thank you..
@Oddant1
I think so
this is from the head command:
@ SRR2830253.1 1 length=151
TCCGTAGGTGGCAAGCGTTGTCCGGCTTTATTGGGCGTAAAGGGCGCGCAGGCGGCTTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGCATGGAAACTGGGAAGCTCAGAGTATCGGAGAGGAAAGCGGATTTCCTAGT
+SRR2830253.1 1 length=151
???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
@ SRR2830253.2 2 length=151
TACGAACTGTGCGAACGTTGTTCGGCTTCACTGGGCTTAAAGGGCGCGTAGGCGGTCTGTCAAGTCTGGGGTGAAAGCCTCCAGCTTAACTGGAGAAGTGCCTTTGATACTGGCGGACTCGAGTGAGGTAGGGGTAGTGGGAACTTCCGGT
+SRR2830253.2 2 length=151
???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
@ SRR2830253.3 3 length=151
TCCGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGTAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGTG
Thank you.
I looked through your output and also looked further into the code where this error is raised and the code is doing the following to your forward reads, your reverse reads, and your barcodes:
Split the header SRR2830253.1 1 length=151 on the first space so we get
id = "SRR2830253.1"
description = "1 length=151"
Then it is trying to assert that the descriptions for forward, reverse, and barcode are identical, but because the length for the barcodes is 12 they are not identical. This error will probably be resolved by removing the "length=x" from your headers.
Additionally, it looks like there is a space between the @ and the id on your header line. This doesn't appear to be causing any issues, but it does seem a bit strange, so if you see any further errors you may want to get rid of those spaces.
Another thing, it seems a bit unusual that the 3rd line of your record is " +SRR2830253.2 2 length=151" as opposed to just +. You may also have to change that, but I'm not sure. I've never seen it be anything but just + before, but I'm not sure if that's illegal or anything.
This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.