Degenerate Primer PROBLEM

(Lisa) #1

Hallo!

I have a problem:

I have used degenerate primers, I need to use the script “qiime feature-classifier extract-reads”
but it doesn’t work. No errors but almost empty and very strange output.

qiime feature-classifier extract-reads
–i-sequences classifier.qza
–p-f-primer TGCGCTAGGTCAAATTGAAA
–p-r-primer GTTTCWGGGTTACCRAACATYACACC
–o-reads classifier_extract.qza

What do you suggest me?

Thank you very much,

Lisa

0 Likes

(Matthew Ryan Dillon) #2

Hi @lisacarraro1982!

Can you provide an example?

0 Likes