DADA2 Mismatched forward and reverse sequence files(different counts of every sample)

[ziyan]

Hi Nicholas!

Thank you so much for the quick answer!

I looked the documents for plugin q2-cutadapt, and disappointedly found that it is not suitable for my data, since my data has already excluded barcodes when I received it from my collaborator. While the data still contains primers, and importantly, the fastq files are NOT demultiplexed!

I searched the forum and found one topic related to me

FASTQ importing

Hi all, I had some help previously on getting an already QCd/primer/barcode trimmed fasta file into QIIME2, this worked well and we're working away happily on this. In the meantime I was able to get the FASTQ from the folks who originally carried out our sequencing. These again don't seem to be raw reads, but have come as a single adapter trimmed fastq with (I presume) R1 and R2 reads joined: @100_1 469 424 24 21 0 0 1 TGAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCATGCCGCGTGCAGGATGACGGCTCTATGAGTTGT…

Due to the answer there is no way to import multiplexed fastq files without barcodes, so I demultiplexed the data useing 'choosetag' function to generate the demultiplexed fastq.

Since this situation, any advice?
Thanks a lot!!!