Hello,
I have just recently started working with qiime2 (version 2020.8), and I am trying to work through the initial steps using my old paired-end fastaq files. The forward and reverse files were already demultiplexed from the person who sequenced them. I was able to import them without a problem, but I started to run into issues when running the dada2 denoise-paired code. Below is the code that I used, from the import to the error I get:
qiime tools import \
--type 'SampleData[PairedEndSequencesWithQuality]'
--input-path qiime-import-practice
--output-path testing_file.qza
--input-format PairedEndFastqManifestPhred33V2
Imported qiime-import-practice as PairedEndFastqManifestPhred33V2 to testing_file.qza
qiime demux summarize \
--i-data testing_file.qza
--o-visualization demux-summary-test.qzv
Saved Visualization to: demux-summary-test.qzv
qiime dada2 denoise-paired \
--i-demultiplexed-seqs testing_file.qza
--p-trim-left-f 5
--p-trim-left-r 5
--p-trunc-len-f 290
--p-trunc-len-r 290
--p-chimera-method pooled
--o-table table-test.qza
--o-representative-sequences rep-seqs-test.qza
--o-denoising-stats denoising-stats-test.qza
Plugin error from dada2:
No features remain after denoising. Try adjusting your truncation and trim parameter settings.
Debug info has been saved to /var/folders/mq/dv8ks0ns3pgc0jy9ltrnf7p80000gn/T/qiime2-q2cli-err-31b72ezf.log
I tried adjusting the parameters like it says, even having both at zero, and I get the same error. I am worried that it may be either the formatting of my fastaq files, or that the quality of them is just too low to do this. Below is one sequence from a forward (top) and reverse (bottom) read of a sample. Additionally, I have added the demux summary image in case that is of help in figuring out this problem:
@M04021:39:000000000-CBCP8:1:1101:12166:3705 1:N:0:TAAGGCGA+AAGGAGTA
GTGCCAGCCGCCGCGGTAATACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATATAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGAGACTGTATAGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCGTGTAGCAGTGAAATGCGTAGATATGCGGAGGAACACCGATGGCGAAGGCAATCCCCTGGACCTGTACTGACGCTCATGCACGAAAGCGTGGGGAGCAAACAGGATGAGATACCCTGGTAGTCCACGCCCTA
+
CCCCCCFGGGEGGGEGCEEGGGGFGGGGFEFGFGFEBFGGGGGGGGFGFGFFFGGGBCEFGGG@CFFGEGGGGGG@FBGCAEG?FCFGGGFFFDFFDFGGEEEGCD<BBFGGGGFEFCFFFA9CBDFFCABFF9BFF,@FDG<FGEE@EFGGGGEG:BE:::,?FFGEFE?FFCF7?<<<BCCEC;EE??7BCFDDEG>C+8<4?>CDC@BEGDGFFCFFGG4;CGGG?7<:<)9BCC;(;5+:8CB?FF:>:D8:>99:>9:(:7F?FF7+5:>>?+<+.2;(6@<A,7)440,.
@M04021:39:000000000-CBCP8:1:1101:12166:3705 2:N:0:TAAGGCGA+AAGGAGTA
GGTGTGTTGCCCGTGTCGGCTTCACTCCTCCACTGCTTAGACGTCGCCAGTACCACCACTGCCCACGCCCACCCCCTCCCTCTTTACTGCCCCTACTGCACGCAGGCTGGGGCACCACACGTGTCTCCATCGCCTGGTACTCCACTCTCTCCACTTTGTCCTGTGGTTGTTGGTTTTTCACTGTCTCAGTACCGAAGCTACCGGGTTCGCTTGCCCGCAGGGGGAGTACGGCCGCCAGTTTGACGCTTCGGGGAATTGCCGCCGTTCACCGCCCCCTTCTGACCTCCTTTCCCTCGGGAGC
+
-,,(()(((((,((,(,)))((,(((,(4.(-(.)((-(((-(())-.0,-,0.(((3)3,1-)994/,((((4)8.)(((,()0+1)2/1).((4(**0;;9+)22,20***+***1.2.7.0+6<1)8+2230==*34>F<<8,,7,8388,@@@,88*,3,7C5*5+53+*@3++<+88+F:D>,+88++3::>B9,,95+448++=@++,,<,5,8+8+6+,,,,,++++++7,,66,,66,6,;6,,=,8++,+,,,-A8
(I hope these upload right!)
Any help would be greatly appreciated! If any other information you would think could be helpful I can try and provide you.
Thank you in advance for your time!
John