Hello
I am running qiime2 (QIIME 2 Core- 2019.1(1548866877) through virtual box. I have demultiplexed pair ended mi-seq sequences. I wanted to trim the adapters using the cutadapt trim-paired plug-in but it raises the following error:
(qiime2-2019.1) qiime2@qiime2core2019-1:~/Desktop/shared/my_qiime2tutorial$ qiime cutadapt trim-paired \
--i-demultiplexed-sequences demux-paired-end.qza
--p-adapter-f ATCTCGTATGCCGTCTTCTGCTTG$
--p-adapter-r AGCGTGTAGATCTCGGTGGTCGCCGTATCATT$ \
Usage: qiime cutadapt trim-paired [OPTIONS]
Try "qiime cutadapt trim-paired --help" for help.
Error: Got unexpected extra argument ( )
(qiime2-2019.1) qiime2@qiime2core2019-1:~/Desktop/shared/my_qiime2tutorial$ --o-trimmed-sequences demux-pairedend-trimmed2.qza
--o-trimmed-sequences: command not found
the error is being raised when i add the option to read the adapter on the reverse read.Not sure what i am doing wrong. the script works fine with only forward read option.
qiime cutadapt trim-paired \
--i-demultiplexed-sequences demux-paired-end.qza
--p-adapter-f ATCTCGTATGCCGTCTTCTGCTTG$
--o-trimmed-sequences demux-pairedend-trimmed1.qza
--verbose
Running external command line application. This may print messages to stdout and/or stderr.
The commands to be run are below. These commands cannot be manually re-run as they will depend on temporary files that no longer exist.
Command: cutadapt --cores 1 --error-rate 0.1 --times 1 --overlap 3 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-pnnpkp_n/515F-G52_S53_L001_R1_001.fastq.gz -p /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-pnnpkp_n/515F-G52_S53_L001_R2_001.fastq.gz --adapter ATCTCGTATGCCGTCTTCTGCTTG$ /tmp/qiime2-archive-fpe7kw9d/7a60c5d1-7e38-47f6-89b0-bc94ad55f1c4/data/515F-G52_S53_L001_R1_001.fastq.gz /tmp/qiime2-archive-fpe7kw9d/7a60c5d1-7e38-47f6-89b0-bc94ad55f1c4/data/515F-G52_S53_L001_R2_001.fastq.gz
This is cutadapt 1.18 with Python 3.6.7
Command line parameters: --cores 1 --error-rate 0.1 --times 1 --overlap 3 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-pnnpkp_n/515F-G52_S53_L001_R1_001.fastq.gz -p /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-pnnpkp_n/515F-G52_S53_L001_R2_001.fastq.gz --adapter ATCTCGTATGCCGTCTTCTGCTTG$ /tmp/qiime2-archive-fpe7kw9d/7a60c5d1-7e38-47f6-89b0-bc94ad55f1c4/data/515F-G52_S53_L001_R1_001.fastq.gz /tmp/qiime2-archive-fpe7kw9d/7a60c5d1-7e38-47f6-89b0-bc94ad55f1c4/data/515F-G52_S53_L001_R2_001.fastq.gz
Processing reads on 1 core in paired-end legacy mode ...
Finished in 5.93 s (46 us/read; 1.30 M reads/minute).
=== Summary ===
Total read pairs processed: 128,443
Read 1 with adapter: 21 (0.0%)
Read 2 with adapter: 0 (0.0%)
Pairs written (passing filters): 128,443 (100.0%)
Total basepairs processed: 77,193,607 bp
Read 1: 38,653,556 bp
Read 2: 38,540,051 bp
Total written (filtered): 77,193,098 bp (100.0%)
Read 1: 38,653,047 bp
Read 2: 38,540,051 bp
=== First read: Adapter 1 ===
Sequence: ATCTCGTATGCCGTCTTCTGCTTG; Type: anchored 3'; Length: 24; Trimmed: 21 times.