Cutadapt trim-paired giving error in qiime2

Hello
I am running qiime2 (QIIME 2 Core- 2019.1(1548866877) through virtual box. I have demultiplexed pair ended mi-seq sequences. I wanted to trim the adapters using the cutadapt trim-paired plug-in but it raises the following error:

(qiime2-2019.1) qiime2@qiime2core2019-1:~/Desktop/shared/my_qiime2tutorial$ qiime cutadapt trim-paired \

--i-demultiplexed-sequences demux-paired-end.qza
--p-adapter-f ATCTCGTATGCCGTCTTCTGCTTG$
--p-adapter-r AGCGTGTAGATCTCGGTGGTCGCCGTATCATT$ \
Usage: qiime cutadapt trim-paired [OPTIONS]
Try "qiime cutadapt trim-paired --help" for help.

Error: Got unexpected extra argument ( )
(qiime2-2019.1) qiime2@qiime2core2019-1:~/Desktop/shared/my_qiime2tutorial$ --o-trimmed-sequences demux-pairedend-trimmed2.qza
--o-trimmed-sequences: command not found

the error is being raised when i add the option to read the adapter on the reverse read.Not sure what i am doing wrong. the script works fine with only forward read option.

qiime cutadapt trim-paired \

--i-demultiplexed-sequences demux-paired-end.qza
--p-adapter-f ATCTCGTATGCCGTCTTCTGCTTG$
--o-trimmed-sequences demux-pairedend-trimmed1.qza
--verbose
Running external command line application. This may print messages to stdout and/or stderr.
The commands to be run are below. These commands cannot be manually re-run as they will depend on temporary files that no longer exist.

Command: cutadapt --cores 1 --error-rate 0.1 --times 1 --overlap 3 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-pnnpkp_n/515F-G52_S53_L001_R1_001.fastq.gz -p /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-pnnpkp_n/515F-G52_S53_L001_R2_001.fastq.gz --adapter ATCTCGTATGCCGTCTTCTGCTTG$ /tmp/qiime2-archive-fpe7kw9d/7a60c5d1-7e38-47f6-89b0-bc94ad55f1c4/data/515F-G52_S53_L001_R1_001.fastq.gz /tmp/qiime2-archive-fpe7kw9d/7a60c5d1-7e38-47f6-89b0-bc94ad55f1c4/data/515F-G52_S53_L001_R2_001.fastq.gz

This is cutadapt 1.18 with Python 3.6.7
Command line parameters: --cores 1 --error-rate 0.1 --times 1 --overlap 3 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-pnnpkp_n/515F-G52_S53_L001_R1_001.fastq.gz -p /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-pnnpkp_n/515F-G52_S53_L001_R2_001.fastq.gz --adapter ATCTCGTATGCCGTCTTCTGCTTG$ /tmp/qiime2-archive-fpe7kw9d/7a60c5d1-7e38-47f6-89b0-bc94ad55f1c4/data/515F-G52_S53_L001_R1_001.fastq.gz /tmp/qiime2-archive-fpe7kw9d/7a60c5d1-7e38-47f6-89b0-bc94ad55f1c4/data/515F-G52_S53_L001_R2_001.fastq.gz
Processing reads on 1 core in paired-end legacy mode ...
Finished in 5.93 s (46 us/read; 1.30 M reads/minute).

=== Summary ===

Total read pairs processed: 128,443
Read 1 with adapter: 21 (0.0%)
Read 2 with adapter: 0 (0.0%)
Pairs written (passing filters): 128,443 (100.0%)

Total basepairs processed: 77,193,607 bp
Read 1: 38,653,556 bp
Read 2: 38,540,051 bp
Total written (filtered): 77,193,098 bp (100.0%)
Read 1: 38,653,047 bp
Read 2: 38,540,051 bp

=== First read: Adapter 1 ===

Sequence: ATCTCGTATGCCGTCTTCTGCTTG; Type: anchored 3'; Length: 24; Trimmed: 21 times.

Hi there @Koirobi_Haldar!

It looks like your command is invalidly formatted, and the error is because the command is incomplete (due to formatting).

qiime cutadapt trim-paired \
    --i-demultiplexed-sequences demux-paired-end.qza \
    --p-adapter-f 'ATCTCGTATGCCGTCTTCTGCTTG$' \
    --p-adapter-r 'AGCGTGTAGATCTCGGTGGTCGCCGTATCATT$' \
    --o-trimmed-sequences demux-pairedend-trimmed1.qza \
    --verbose

A few things to note --- I included a backslash on all but the final line --- these tell your shell "hey bud, wait for me to finish writing this command on more than one line, okay?!" Also, I wrapped your adapter queries in quotes, since you have special characters ($) it is good practice to quote there (although not required in all shells).

Keep us posted! :qiime2:

Thankyou the command is now working with the quotes. Also when i wrote the command in a single line the command runs fine without quotes for the sequence.

qiime cutadapt trim-paired --i-demultiplexed-sequences demux-paired-end.qza --p-adapter-f ATCTCGTATGCCGTCTTCTGCTTG$ --p-adapter-r AGCGTGTAGATCTCGGTGGTCGCCGTATCATT$ --o-trimmed-sequences demux-pairedend-trimmed4.qza --verbose

Koirobi.