Creating metadata file from different sources

Hello,

I'm having a project for which I have 2 raw data fastq files (meaning I have the barcodes for each sample) and 1 already-trimmed fasta files.
I managed to make a combined-table.qza artifact, composed of a table.qza for the first 2 projects together, and the third project table.qza file which I made from the .biom table I got.
However, now I want to create a table.qzv artifact, and since I don't have the 3rd project barcodes, I just can't include it in the metadata file required.
How can I solve this? I do have the 3rd project codes per sample each in this shape:

M01323:277:000000000 AKKUH:1:1101:12865:1898_1:N:0:120
TGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGG

Where the N:0:120 is unique per sample fasta files.

Thank you,
Barak

Hi @barakdror,

I think if you've got tables that are okay to merge (i.e. trimmed to the same length and then denoised using the same algorithm... chimera slaying still a point of discussion, or picked closed reference at the same specificity with the same algorithm against the same database), you're fine to merge.

For your metadata file, you can leave the barcode column blank. Actually, at this point, Im not sure its a required column for your QIIME mapping file. Im about 99% sure I dont have "barcode" in my current project, since I got my data demultiplexed already and it wasnt relevant. If it is required and Im wrong, you should just be able to leave it blank - as in you dont have a barcode.

Best,
Justine

Hi, thanks for the reply.
It seems like some commands are ok with me not having barcodes in my metadata (for instance taxonomy), but others are not- as i'm getting an error message stating that samples in the table.qza are not present in the metadata file.

Hi @barakdror,

Have you checked that all your samples are in your metadata file? That seems less like a barcode issues and more like you don't have IDs that line up with your metadata.

Best,
Justine