Thank you @Nicholas_Bokulich for your reply! So sorry for the delay in response.
I have imported my data & have tried to dereplicate the sequences with vsearch. However, when I try to run that command I get an error:
Plugin error from vsearch:
list index out of range
I'm not sure why I would get that error message. I checked on the forum for previous issues with this & found that another user had encountered this issue with another issue. However, the user fixed their issue with a simple character replacement. I don't have issues with that, however. Here are the first couple of lines of my .FASTA file:
JH_LCl_51
ANCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCNAGGTCAATCTGGGGTGGTTTGCTTACTGGTAAGCCCCTTTCTTCGGTGCGTCCCGCAAATTTGCTGCGTTCANTGCCGATAAGGGAGCTGCCAACTACTTTTGAGGCGAGTCCGCNCGCGGAGGCGGGACNNACGCCNATCACCAAGCTNAGCTTGAATTTTGAAATGACGCTCNAACAGGCATGCCCTAAGGAATACCAAAGGGCGCAATGTGCGTTCANNNATTCNATGATTCACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCANAGCCAAGAGATCCATTGCCGAAAGTT
JH_HCl_73
AGCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCNAGGTCAACCTGATAAAATGGGGGGTTGTTGGCAAGCAACCACCGAGACCCTATAGCGAGAAAATTTACTACGCTCANAGCTCGATGGCACCGCCACTGAGTTTAGGGGCTGCGAGACCGCANGCTCCAATACCAAGCGTGAGCTTGAGGGGTTGTAATGACGCTCGAACAGGCATGCCCCGCGNAATACCACGGGGCGCAATGTGCGTTCAAAGATTCNATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCANAACCAAGTGATCCGTTGTCAAAAGTT
As you can see, I do not have those character issues with my headers. Any ideas as to what else it could be?