"All features were filtered out of the data"

[LauraMason]

Here's one:
16s-merged-seqs60_99.tsv (1.3 MB)

[thermokarst]

Ah, that explains it, thanks for sharing, @LauraMason! This isn't a TSV file, it is just a FASTA file with an extra line at the beginning of the file. A TSV (tab-separated values) file is basically a spreadsheet - think rows and columns. An actual TSV representation of these data would look like this

FeatureID                           Sequence
00133b75708d24f603810a4625f75e78    ATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTGCTAAGGAGGTACCGTCATCGCTCCGGGTATTAACCGGAAC
001bc4367fa0ff4250b5d2856a17653d    ATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTCCTCACCCGGTACCGTCAGGCCGGCCGAAGCCGGCTGTTCG
...

Make sense?

Here is what your file looks like loaded up into a spreadsheet program:

QIIME 2 is seeing the same thing, and is looking for ids like >00133b75708d24f603810a4625f75e78 (note the >) and ATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTGCTAAGGAGGTACCGTCATCGCTCCGGGTATTAACCGGAAC, when it should be looking for IDs like 00133b75708d24f603810a4625f75e78 and 001bc4367fa0ff4250b5d2856a17653d.

When you provide the QZA representation of these data, QIIME 2 knows how to convert it as necessary. Thanks!