Here's one:
16s-merged-seqs60_99.tsv (1.3 MB)
Ah, that explains it, thanks for sharing, @LauraMason! This isn't a TSV file, it is just a FASTA file with an extra line at the beginning of the file. A TSV (tab-separated values) file is basically a spreadsheet - think rows and columns. An actual TSV representation of these data would look like this
FeatureID Sequence
00133b75708d24f603810a4625f75e78 ATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTGCTAAGGAGGTACCGTCATCGCTCCGGGTATTAACCGGAAC
001bc4367fa0ff4250b5d2856a17653d ATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTCCTCACCCGGTACCGTCAGGCCGGCCGAAGCCGGCTGTTCG
...
Make sense?
Here is what your file looks like loaded up into a spreadsheet program:
QIIME 2 is seeing the same thing, and is looking for ids like >00133b75708d24f603810a4625f75e78 (note the >) and ATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTGCTAAGGAGGTACCGTCATCGCTCCGGGTATTAACCGGAAC, when it should be looking for IDs like 00133b75708d24f603810a4625f75e78 and 001bc4367fa0ff4250b5d2856a17653d.
When you provide the QZA representation of these data, QIIME 2 knows how to convert it as necessary. Thanks!
This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.
