# \#feature-table **URL:** https://forum.qiime2.org/tag/feature-table/33.md [Latest](https://forum.qiime2.org/latest.md) · [Categories](https://forum.qiime2.org/categories.md) · [Tags](https://forum.qiime2.org/tags.md) --- ## [.biom to .tsv is losing per-sample data from FeatureTable\[Frequency\]](https://forum.qiime2.org/t/biom-to-tsv-is-losing-per-sample-data-from-featuretable-frequency/34311)
**Author:** [@Emma\_Gardner](https://forum.qiime2.org/u/Emma_Gardner)\ **Replies:** 1\ **Last updated:** [September 3, 2026, 1:25pm UTC](https://forum.qiime2.org/t/biom-to-tsv-is-losing-per-sample-data-from-featuretable-frequency/34311 "2026-09-03T13:25:22Z")
.biom to .tsv is losing per-sample data from FeatureTable\[Frequency\] Hi! I'm trying to export my .qza files so that I can use some other analysis tools in R, and for some reason, it looks like I'm losing my per-sample fr… --- ## [Qiime version and singletons](https://forum.qiime2.org/t/qiime-version-and-singletons/34151)
**Author:** [@Alessandro](https://forum.qiime2.org/u/Alessandro)\ **Replies:** 3\ **Last updated:** [April 27, 2026, 11:45pm UTC](https://forum.qiime2.org/t/qiime-version-and-singletons/34151 "2026-04-27T23:45:36Z")
Hello everyone, I’m running into a difference between QIIME 2 versions and I’d like to understand what’s going on. At the end of 2025, I performed 16S analyses using QIIME 2 version 2025.10.1. With that version, the fea… --- ## [Moving pictures - feature table and feature data summaries returning strange error codes](https://forum.qiime2.org/t/moving-pictures-feature-table-and-feature-data-summaries-returning-strange-error-codes/34056)
**Author:** [@pants](https://forum.qiime2.org/u/pants)\ **Replies:** 1\ **Last updated:** [March 13, 2026, 8:46am UTC](https://forum.qiime2.org/t/moving-pictures-feature-table-and-feature-data-summaries-returning-strange-error-codes/34056 "2026-03-13T08:46:47Z")
Hello all, I’m running Qiime2 version 2024.10 in conda at my lab. They set me up going through the tutorial and I ran into an error - is it because of the versioning? Command: qiime feature-table summarize --i-table … --- ## [Advice in best practice for handling multiple sequencing runs and subset analyses in QIIME 2 (DADA2)](https://forum.qiime2.org/t/advice-in-best-practice-for-handling-multiple-sequencing-runs-and-subset-analyses-in-qiime-2-dada2/33913)
**Author:** [@ppm](https://forum.qiime2.org/u/ppm)\ **Replies:** 2\ **Last updated:** [January 16, 2026, 8:55am UTC](https://forum.qiime2.org/t/advice-in-best-practice-for-handling-multiple-sequencing-runs-and-subset-analyses-in-qiime-2-dada2/33913 "2026-01-16T08:55:26Z")
I would appreciate some advice on the best workflow for my analysis. I have two sets of samples generated from two different sequencing runs. Both runs are 16S rRNA gene amplicons (V3–V4 region, 2×300 bp). One run contai… --- ## [How to perform filtering step for forward read only analysis?](https://forum.qiime2.org/t/how-to-perform-filtering-step-for-forward-read-only-analysis/33856)
**Author:** [@Qiime2\_user](https://forum.qiime2.org/u/Qiime2_user)\ **Replies:** 13\ **Last updated:** [December 31, 2025, 5:39am UTC](https://forum.qiime2.org/t/how-to-perform-filtering-step-for-forward-read-only-analysis/33856 "2025-12-31T05:39:15Z")
Hi all, I’m analyzing 16S rRNA sequencing data where the original data are paired-end, but the reverse reads are too short for successful merging. Because of this, I am performing the full pipeline using forward reads o… --- ## [Filter table : taxonomy](https://forum.qiime2.org/t/filter-table-taxonomy/33857)
**Author:** [@Zeina](https://forum.qiime2.org/u/Zeina)\ **Replies:** 1\ **Last updated:** [December 10, 2025, 2:17pm UTC](https://forum.qiime2.org/t/filter-table-taxonomy/33857 "2025-12-10T14:17:15Z")
Hi all, I am trying to filter my taxonomy table by removing specific entries (Chloroplast, Mitochondria, Eukaryota ..), but in the final table only the Chloroplast sequences were actually removed. I execute the command… --- ## [Questions about performing quality control with dada2 and generating a feature table](https://forum.qiime2.org/t/questions-about-performing-quality-control-with-dada2-and-generating-a-feature-table/33829)
**Author:** [@Yangfu123](https://forum.qiime2.org/u/Yangfu123)\ **Replies:** 2\ **Last updated:** [November 29, 2025, 10:39am UTC](https://forum.qiime2.org/t/questions-about-performing-quality-control-with-dada2-and-generating-a-feature-table/33829 "2025-11-29T10:39:03Z")
When using DADA2 for quality control and feature table construction with paired-end sequences, I employ the following code: qiime dada2 denoise-paired --i-demultiplexed-seqs paired-end-demux.qza --p-trunc-len-f XXX--p-t… --- ## [Guidance for feature filtering step of qiime2](https://forum.qiime2.org/t/guidance-for-feature-filtering-step-of-qiime2/33788)
**Author:** [@Qiime2\_user](https://forum.qiime2.org/u/Qiime2_user)\ **Replies:** 4\ **Last updated:** [November 19, 2025, 2:49pm UTC](https://forum.qiime2.org/t/guidance-for-feature-filtering-step-of-qiime2/33788 "2025-11-19T14:49:59Z")
Can I please get some help and guidance as to how to decide on the feature filtering criteria in qiime2? qiime feature-table filter-features --i-table table-dada2.qza --p-min-frequency ??? --p-min-samples ??? --o-fi… --- ## [Converting 16S V3–V4 ASV reads to absolute copy numbers (qPCR / spike-in calibration?)](https://forum.qiime2.org/t/converting-16s-v3-v4-asv-reads-to-absolute-copy-numbers-qpcr-spike-in-calibration/33705)
**Author:** [@Rainjie](https://forum.qiime2.org/u/Rainjie)\ **Replies:** 3\ **Last updated:** [October 9, 2025, 6:13pm UTC](https://forum.qiime2.org/t/converting-16s-v3-v4-asv-reads-to-absolute-copy-numbers-qpcr-spike-in-calibration/33705 "2025-10-09T18:13:19Z")
Hi, good day Qiime2 team. I’m working with 16S rRNA V3–V4 amplicons from bacterial strains using universal primers. After processing the raw .fastq.gz files with DADA2 in QIIME 2, I have an ASV table (samples × ASVs, re… --- ## [16S SRNA](https://forum.qiime2.org/t/16s-srna/33536)
**Author:** [@yesiso](https://forum.qiime2.org/u/yesiso)\ **Replies:** 1\ **Last updated:** [August 2, 2025, 8:44am UTC](https://forum.qiime2.org/t/16s-srna/33536 "2025-08-02T08:44:56Z")
What I want to ask is that if I collect the 16S SRNA data from 200 samples on the NCBI website, and I have grouped the data by type, not by primer, but by process type, and now when I look at the statistics, I see that s… --- ## [Merging qiime2 sample metadata with exterior taxonomic classifications](https://forum.qiime2.org/t/merging-qiime2-sample-metadata-with-exterior-taxonomic-classifications/33431)
**Author:** [@rwhsiques](https://forum.qiime2.org/u/rwhsiques)\ **Replies:** 1\ **Last updated:** [July 13, 2025, 3:24pm UTC](https://forum.qiime2.org/t/merging-qiime2-sample-metadata-with-exterior-taxonomic-classifications/33431 "2025-07-13T15:24:14Z")
Hello! I am relatively new to bioinformatics, and qiime 2 especially, so bear with me and let me know if anything needs clarified or corrected! I am working on diet metabarcoding analyses (arthropods eaten by dragonflie… --- ## [Feature table and representative sequences for downstream analyses](https://forum.qiime2.org/t/feature-table-and-representative-sequences-for-downstream-analyses/33297)
**Author:** [@Anandi\_Batabyal](https://forum.qiime2.org/u/Anandi_Batabyal)\ **Replies:** 1\ **Last updated:** [June 11, 2025, 8:21pm UTC](https://forum.qiime2.org/t/feature-table-and-representative-sequences-for-downstream-analyses/33297 "2025-06-11T20:21:39Z")
Hello Users, I've been using QIIME2 for some time now in my research, where I’m investigating the effects of maternal interventions in mice on the gut microbiome of their offspring. For each dam (mouse mom), I have mult… --- ## [feature-table summarize plug in error and metadata length of index](https://forum.qiime2.org/t/feature-table-summarize-plug-in-error-and-metadata-length-of-index/33144)
**Author:** [@Joecliff](https://forum.qiime2.org/u/Joecliff)\ **Replies:** 3\ **Last updated:** [May 29, 2025, 5:37pm UTC](https://forum.qiime2.org/t/feature-table-summarize-plug-in-error-and-metadata-length-of-index/33144 "2025-05-29T17:37:01Z")
Hifor a little context, im working with 16s nanopore data, i already did preprocessing filtering clustering with a previous pipeline- proname(GitHub - benn888/PRONAME: PRONAME is an open-source bioinformatics pipeline … --- ## [Feature table with core features for beta diversity analysis](https://forum.qiime2.org/t/feature-table-with-core-features-for-beta-diversity-analysis/33030)
**Author:** [@Sofia\_Prieto](https://forum.qiime2.org/u/Sofia_Prieto)\ **Replies:** 2\ **Last updated:** [May 9, 2025, 9:48am UTC](https://forum.qiime2.org/t/feature-table-with-core-features-for-beta-diversity-analysis/33030 "2025-05-09T09:48:44Z")
Hi! I'm working on a dataset of 200 samples of 16S rRNA gene sequences from insect gut, divided into 6 groups according to the species. I'd like to perform some diversity analysis only with core features. I've got the c… --- ## [Alpha diversity with filtered raw data or unfiltered raw data](https://forum.qiime2.org/t/alpha-diversity-with-filtered-raw-data-or-unfiltered-raw-data/33045)
**Author:** [@saif\_s](https://forum.qiime2.org/u/saif_s)\ **Replies:** 1\ **Last updated:** [April 24, 2025, 1:25pm UTC](https://forum.qiime2.org/t/alpha-diversity-with-filtered-raw-data-or-unfiltered-raw-data/33045 "2025-04-24T13:25:40Z")
Hi, I'm working on my qiime2 output in R and I filtered for low abundance taxa and low reads in my phyloseq object. I'm wondering if I should estimate alpha diversity on the unfiltered untrimmed phyloseq object or the t… --- ## [biom add-metadata: Error in biom file while adding Taxonomy](https://forum.qiime2.org/t/biom-add-metadata-error-in-biom-file-while-adding-taxonomy/32919)
**Author:** [@Zeina](https://forum.qiime2.org/u/Zeina)\ **Replies:** 3\ **Last updated:** [April 7, 2025, 3:48pm UTC](https://forum.qiime2.org/t/biom-add-metadata-error-in-biom-file-while-adding-taxonomy/32919 "2025-04-07T15:48:09Z")
Hi, I am trying to add taxonomy to my biom file using the command below. Here an exemple of the taxonomy file : #OTU ID taxonomy Confidence b02e35c471964bc58fda61d0edffa5ad d\_\_Bacteria;p\_\_Proteobacteria;c\_\_Gammaproteoba… --- ## [Unable to find all taxon as a result of taxanomic analysis](https://forum.qiime2.org/t/unable-to-find-all-taxon-as-a-result-of-taxanomic-analysis/32730)
**Author:** [@HafizaHira](https://forum.qiime2.org/u/HafizaHira)\ **Replies:** 1\ **Last updated:** [March 12, 2025, 1:55pm UTC](https://forum.qiime2.org/t/unable-to-find-all-taxon-as-a-result-of-taxanomic-analysis/32730 "2025-03-12T13:55:27Z")
I have paired-end sequencing reads of sample and I followed the same pipeline described in \[“Moving Pictures” tutorial — QIIME 2 2024.10.1 documentation\] for finding which bacterial species are present in which sample an… --- ## [OTU Tables Relative Frequency to Relative Abundance](https://forum.qiime2.org/t/otu-tables-relative-frequency-to-relative-abundance/32530)
**Author:** [@jen.herting](https://forum.qiime2.org/u/jen.herting)\ **Replies:** 9\ **Last updated:** [March 4, 2025, 3:59pm UTC](https://forum.qiime2.org/t/otu-tables-relative-frequency-to-relative-abundance/32530 "2025-03-04T15:59:05Z")
Hello all, I am wondering how the BIOM and TSV files relate to the .csv file downloaded from QIIME2 View Website where I put in the barplots.qzv file? Also, I wanted to ask what the difference between Relative Frequency… --- ## [Converting Ion Torrent Amplicon Data (V3-V4) to PICRUSt2-Compatible Files (.fna and .biom)](https://forum.qiime2.org/t/converting-ion-torrent-amplicon-data-v3-v4-to-picrust2-compatible-files-fna-and-biom/32412)
**Author:** [@Sudipto\_Biswas](https://forum.qiime2.org/u/Sudipto_Biswas)\ **Replies:** 7\ **Last updated:** [February 28, 2025, 9:10pm UTC](https://forum.qiime2.org/t/converting-ion-torrent-amplicon-data-v3-v4-to-picrust2-compatible-files-fna-and-biom/32412 "2025-02-28T21:10:41Z")
Hi Qiime2 Community, I am working with Ion Torrent amplicon (V3-V4) sequencing data that is already demultiplexed. The data is in FASTQ format, and the sequences look like this: @27D1N:01366:11662 CCTACGGGAGGCAGCAGTAGG… --- ## [Corrupted BIOM export?](https://forum.qiime2.org/t/corrupted-biom-export/32605)
**Author:** [@raivo-otus](https://forum.qiime2.org/u/raivo-otus)\ **Replies:** 2\ **Last updated:** [February 25, 2025, 1:39pm UTC](https://forum.qiime2.org/t/corrupted-biom-export/32605 "2025-02-25T13:39:52Z")
Hey! I am experiencing some issues with trying to get my feature table out of Qiime2. The version of qiime2 I am using is 24.10-amplicon. The issue I am having is seemingly corrupted or flawed feature table file. I ha… --- ## [Big data analysis in QIIME2: how to obtain the level-7.csv](https://forum.qiime2.org/t/big-data-analysis-in-qiime2-how-to-obtain-the-level-7-csv/32573)
**Author:** [@Shreya](https://forum.qiime2.org/u/Shreya)\ **Replies:** 1\ **Last updated:** [February 19, 2025, 1:06pm UTC](https://forum.qiime2.org/t/big-data-analysis-in-qiime2-how-to-obtain-the-level-7-csv/32573 "2025-02-19T13:06:46Z")
I obtained the table.qza from qiime2 and it contains almost 1600 samples in total. When I get the output of taxabarplot.qzv from the above table and import it in qiime2 view for visualisation, it crashes and I am unable … --- ## [setting --p-min-frequency](https://forum.qiime2.org/t/setting-p-min-frequency/32131)
**Author:** [@fatihfarabigazali](https://forum.qiime2.org/u/fatihfarabigazali)\ **Replies:** 2\ **Last updated:** [December 16, 2024, 9:47pm UTC](https://forum.qiime2.org/t/setting-p-min-frequency/32131 "2024-12-16T21:47:23Z")
I am trying to set the parameter for --p-min-frequency in the following code: qiime feature-table filter-samples \\ --i-table feature-table.qza \\ --p-min-frequency 1500 \\ --o-filtered-table filtered-table.qza I re… --- ## [Not able to find E. coli in my taxonomy file](https://forum.qiime2.org/t/not-able-to-find-e-coli-in-my-taxonomy-file/32050)
**Author:** [@NivedhithaU](https://forum.qiime2.org/u/NivedhithaU)\ **Replies:** 3\ **Last updated:** [December 5, 2024, 9:27am UTC](https://forum.qiime2.org/t/not-able-to-find-e-coli-in-my-taxonomy-file/32050 "2024-12-05T09:27:49Z")
Hello, I am analyzing mouse fecal samples. We have sequenced the V3-V4 region of the 16s rRNA and the taxonomic classification has been done based on silva-138-99-tax.qza. The code I used is given below. 1. Importing f… --- ## [16S metagenomic analsys](https://forum.qiime2.org/t/16s-metagenomic-analsys/31879)
**Author:** [@Hongo](https://forum.qiime2.org/u/Hongo)\ **Replies:** 1\ **Last updated:** [November 14, 2024, 4:50pm UTC](https://forum.qiime2.org/t/16s-metagenomic-analsys/31879 "2024-11-14T16:50:33Z")
Hi everyone, Is there a pipeline to perform 16S metagenomic long read analysis ? My data look like : zcat in00345\_1V1V9.fastq.gz | head @m64524e\_241022\_205042/2/ccs/9839\_11335 GGTTTGATC I use the last version of QII… --- ## [Dada2 unable to run](https://forum.qiime2.org/t/dada2-unable-to-run/31761)
**Author:** [@Ashoi\_Dantra](https://forum.qiime2.org/u/Ashoi_Dantra)\ **Replies:** 1\ **Last updated:** [October 29, 2024, 7:02pm UTC](https://forum.qiime2.org/t/dada2-unable-to-run/31761 "2024-10-29T19:02:42Z")
Hi, Thankyou so much for the patience for yet another silly question. I am tired of running the below command: qiime dada2 denoise-paired --i-demultiplexed-seqs demux-paired-end.qza --p-trunc-len-f 0 --p-trunc-le… --- ## [Advice on feature table filtering](https://forum.qiime2.org/t/advice-on-feature-table-filtering/31747)
**Author:** [@Vanshika\_Sharma](https://forum.qiime2.org/u/Vanshika_Sharma)\ **Replies:** 1\ **Last updated:** [October 28, 2024, 12:46pm UTC](https://forum.qiime2.org/t/advice-on-feature-table-filtering/31747 "2024-10-28T12:46:53Z")
Hello QIIME 2 community, I'm working on analyzing microbial community data and need some advice on two aspects: Feature Table Filtering - Minimum Frequency Threshold I want to retain the most relevant features while … --- ## [Can i use taxa collapse table for network analysis??](https://forum.qiime2.org/t/can-i-use-taxa-collapse-table-for-network-analysis/31700)
**Author:** [@svbreqwaiu01](https://forum.qiime2.org/u/svbreqwaiu01)\ **Replies:** 4\ **Last updated:** [October 25, 2024, 5:00pm UTC](https://forum.qiime2.org/t/can-i-use-taxa-collapse-table-for-network-analysis/31700 "2024-10-25T17:00:25Z")
i exported taxonomic table after classification! The table is below.. So.., can i use this for network analysis? for not?? Thank you --- ## [Removal of Overrepresented sequences from 16S metagenomic sequences](https://forum.qiime2.org/t/removal-of-overrepresented-sequences-from-16s-metagenomic-sequences/31524)
**Author:** [@Rashmi\_Ira](https://forum.qiime2.org/u/Rashmi_Ira)\ **Replies:** 8\ **Last updated:** [October 1, 2024, 7:04am UTC](https://forum.qiime2.org/t/removal-of-overrepresented-sequences-from-16s-metagenomic-sequences/31524 "2024-10-01T07:04:29Z")
Hi, I am working with a 16S metagenomic sample targeting the V3-V4 region, with paired-end reads that have varying lengths. The forward read length is 260 bp and the reverse read length is 134 bp. Due to the shorter rea… --- ## [Merging after denoising step](https://forum.qiime2.org/t/merging-after-denoising-step/31318)
**Author:** [@Ayushi\_Bhagat](https://forum.qiime2.org/u/Ayushi_Bhagat)\ **Replies:** 14\ **Last updated:** [September 11, 2024, 10:36am UTC](https://forum.qiime2.org/t/merging-after-denoising-step/31318 "2024-09-11T10:36:11Z")
Greetings, I am running QIIME2 (2023 version) and I have a few questions regarding one of the data. Everything is fine but after the denoising step, I am not getting enough merged sequences because of which I am losing … --- ## [Manually Adding Positive Controls to classifier or reference database](https://forum.qiime2.org/t/manually-adding-positive-controls-to-classifier-or-reference-database/28733)
**Author:** [@alexkrohn](https://forum.qiime2.org/u/alexkrohn)\ **Replies:** 4\ **Last updated:** [August 30, 2024, 6:30pm UTC](https://forum.qiime2.org/t/manually-adding-positive-controls-to-classifier-or-reference-database/28733 "2024-08-30T18:30:22Z")
I'm wondering if there is an easy way to add sequences/taxonomy to a reference database created with QIIME. I'm working on an eDNA metabarcoding project and want to detect species not present on NCBI's GenBank database.… [Next page](https://forum.qiime2.org/tag/feature-table/33.md?match_all_tags=true&page=1&tags%5B%5D=feature-table)