# Troubles importing FASTA file
**URL:** https://forum.qiime2.org/t/troubles-importing-fasta-file/2546
**Category:** User Support
**Tags:** fasta, import
**Created:** [January 11, 2018, 8:40pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546 "2018-01-11T20:40:01Z")
**Posts on this page:** 10
**Page:** 1
### Author:  [@aeriel.belk](https://forum.qiime2.org/u/aeriel.belk)
#### Post date: [January 11, 2018, 8:40pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/1 "2018-01-11T20:40:01Z")
Hello!
I am having the same problem as @Pseudomonas84 importing my seqs.fna file into qiime2. I tried following your suggestion of including the source format parameter, so my command looked like this:
qiime tools import
--input-path reference-hit.seqs.fa \
--output-path PMI3\_spring\_rep-seqs.qza
--source-format QIIME1DemuxFormat
--type SampleData[Sequences]
I also received the error: reference-hit.seqs.fa is not a(n) QIIME1DemuxFormat file
Here is the head of my file:
head reference-hit.seqs.fa
```auto
>TACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGCGGCGCGGTAAGTCGGGTGTGAAATCTCGGAGCTTAACTCCGAAACTG
TACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGCGGCGCGGTAAGTCGGGTGTGAAATCTCGGAGCTTAACTCCGAAACTG
>TACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGTTTAGTAAGTCAGTGGTGAAAGCCCATCGCTCAACGGTGGAACGG
TACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGTTTAGTAAGTCAGTGGTGAAAGCCCATCGCTCAACGGTGGAACGG
>TACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGTGGTGATGCAAGTCTGGTGTGAAATCTCGGAGCTCAACTCCGAAATTG
TACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGTGGTGATGCAAGTCTGGTGTGAAATCTCGGAGCTCAACTCCGAAATTG
>TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGATTGCTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTG
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGATTGCTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTG
>TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTG
TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTG
```
My file does not appear to have any lowercase letters, however I noticed that the ID line is the same as my sequence, and I'm wondering if that is the problem. Is there a way to fix that, or do you have another suggestion as to what the problem might be?
Thanks!
Aeriel 😄
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [January 11, 2018, 8:52pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/2 "2018-01-11T20:52:03Z")
Hi @aeriel.belk,
your sequences are in standard fasta format, not a QIIME1DemuxFormat file. You can follow [this tutorial example](https://docs.qiime2.org/2017.12/tutorials/importing/#id22) to import to a `FeatureData[Sequence]` file.
I hope that helps!
---
### Author:  [@aeriel.belk](https://forum.qiime2.org/u/aeriel.belk)
#### Post date: [January 11, 2018, 9:03pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/3 "2018-01-11T21:03:32Z")
Thanks for your quick reply!
Unfortunately, when I run the command as described in the tutorial I am given the error: reference-hit.seqs.fa is not a(n) DNAFASTAFormat file
This is why I tried using the other method originally, I guess I am unsure what format my file is then, if it isn't either of these.
---
### Author:  [@thermokarst](https://forum.qiime2.org/u/thermokarst)
#### Post date: [January 12, 2018, 1:23pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/5 "2018-01-12T13:23:41Z")
Hi @aeriel.belk, sorry to hear things aren't going well ☹ . I just created a file (`seqs.fna`) using the output from the `head` command you listed [above](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546), and imported using the following command (this is what @Nicholas_Bokulich linked to [above](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/2)):
```bash
$ qiime tools import \
--input-path seqs.fna \
--output-path sequences.qza \
--type 'FeatureData[Sequence]'
```
The sequences imported without raising an error. This is noteworthy, because[the code that performs the validation](https://github.com/qiime2/q2-types/blob/master/q2_types/feature_data/_format.py#L134-L150) of this format only reads the first 5 records to make its assessment --- so even if your file has more records in it, the error you mentioned seeing above would've been caused by using just the first 5 records, which means I should have seen that error in my test (this isn't entirely true - the sniffer could detect issues in other lines of the file).
Some requests:
- Can you please double check that your import command is importing the file you want?
- Can you please copy-and-paste the exact import command you are running?
- Can you please copy-and-paste the complete error you are seeing?
Thanks! 🦖
---
### Author:  [@aeriel.belk](https://forum.qiime2.org/u/aeriel.belk)
#### Post date: [January 12, 2018, 3:21pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/7 "2018-01-12T15:21:18Z")
Thanks @thermokarst!
I tried again, I am certain that I am using the correct fasta file in this command:
qiime tools import
--input-path reference-hit.seqs.fa
--output-path sequences.qza
--type 'FeatureData[Sequence]'
There was a problem importing reference-hit.seqs.fa:
reference-hit.seqs.fa is not a(n) DNAFASTAFormat file
Thanks!
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [January 12, 2018, 3:35pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/8 "2018-01-12T15:35:14Z")
Hi @aeriel.belk,
If your file is small enough, could you please post it here and we could attempt to debug?
what version of QIIME2 are you running?
---
### Author:  [@aeriel.belk](https://forum.qiime2.org/u/aeriel.belk)
#### Post date: [January 12, 2018, 3:38pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/9 "2018-01-12T15:38:18Z")
It is attached below. I am currently running QIIME2-2017.12, but I had the same issue in 2017.11 and 2017.10
[reference-hit.seqs.fa.zip](https://cdck-file-uploads-global.s3.dualstack.us-west-2.amazonaws.com/flex002/uploads/qiime21/original/2X/2/242cba67d7f6677ef08456ccf9e8f334e992724c.zip) (261.7 KB)
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [January 12, 2018, 3:56pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/10 "2018-01-12T15:56:23Z")
Hi @aeriel.belk,
It looks like the issue is that a number of sequences contain lower-case characters. use the following to convert your file before importing:
`tr 'acgt' 'ACGT' < reference-hit.seqs.fa > seqs.fna`
That will do the trick!
---
### Author:  [@aeriel.belk](https://forum.qiime2.org/u/aeriel.belk)
#### Post date: [January 12, 2018, 4:15pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/11 "2018-01-12T16:15:15Z")
That worked, thanks!
---
### Author:  [@system](https://forum.qiime2.org/u/system)
#### Post date: [February 12, 2018, 10:15pm UTC](https://forum.qiime2.org/t/troubles-importing-fasta-file/2546/12 "2018-02-12T22:15:18Z")
This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.