`, so I went through and deleted everything except for that; giving headers and sequences like this:
> k141\_0
> GCCAATCCTTACCTTCATAGAACTGGACAGGCTCAAGATCGAGACCTATATACCAGAGGAAGTCGCCTTACACTTATATGATAAAGAAAAACAGAAACTATGTCAAGTAGGAATCCATTTCGATACAGATCCCGAACGGACAATCACCCCTTCCGATTTATATGTGTCTAAAAGTACGACAAACAATAACCTCTCTTATCTACTGACCGCCATTATCCCCAACCCCGATATGGAATGGCTGGGCGGAATGAGTGGAATCCTCTCGATCGACCTACCCAAAGAAGAGCGGTCTCAAAATCTATGGCTTCCCTTAACGGCTATCTGTCATCGCCCCCAAAAAGG
> k141\_42822
> CGGGTACTGTTGTCATGAATGGAAAGCAATATATGTGGAATACATGGGGAGAAATACTGATTCCCGCATCAGATTCGCAGGTTTGGGCGACGTATGCCAATGAATTCTATGAAGGTGGTCCTGCCGTCACGTTCCGCAAGCTGGGCAAAGGCACGGTGACATATGTCGGAGTGGACAGCCATAATGGTGCATTGGAAAAAGATATCTTGAAGAAATTATATGCGCAACTGAGTATTCCCGTTATGGATTTGCCTTATGGAGTTACGGTGGAATACCGGAATGGTTTGGGGATAGTGCTGAATTATGCTGATCGTCCTTATACATTCAACTTACCTGAAGGAAGTAAGGTTTTGATAGGGACGAAAGAGATTCCGACAGCAGGGGTATTGGT
Any help with this would be greatly appreciated.
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [September 24, 2019, 4:12pm UTC](https://forum.qiime2.org/t/trouble-importing-megahit-assemblies/11648/2 "2019-09-24T16:12:41Z")
Welcome to the forum, @Nick_D!
> [@Nick\_D](#):
>
> TypeError: Semantic type SampleData[Sequence] does not have a compatible directory format.
Try `FeatureData[Sequence]`
Let us know if that works for you!
---
### Author:  [@Nick\_D](https://forum.qiime2.org/u/Nick_D)
#### Post date: [September 25, 2019, 7:29am UTC](https://forum.qiime2.org/t/trouble-importing-megahit-assemblies/11648/3 "2019-09-25T07:29:19Z")
Hi Nicholas,
Thanks for the help, I was able to successfully import the data using FeatureData[Sequence]. Unfortunately, when I try to use "vsearch dereplicate-sequences" it throws the following error:
(1/1) Invalid value for "--i-sequences": Expected an artifact of at least
type SampleData[Sequences] | SampleData[SequencesWithQuality] |
SampleData[JoinedSequencesWithQuality]. An artifact of type
FeatureData[Sequence] was provided.
Is there any way to import the assemblies as SampleData[Sequences], or convert the FeatureData[Sequences] file to SampleData[Sequences] so that I can dereplicate it?
---
### Author:  [@thermokarst](https://forum.qiime2.org/u/thermokarst)
#### Post date: [September 25, 2019, 2:23pm UTC](https://forum.qiime2.org/t/trouble-importing-megahit-assemblies/11648/4 "2019-09-25T14:23:43Z")
> [@Nick\_D](#):
>
> Is there any way to import the assemblies as SampleData[Sequences]
The megahit assemblies are per-sample, right? You could multiplex all the samples (while modifying the reflines to match the [necessary format](http://qiime.org/documentation/file_formats.html#post-split-libraries-fasta-file-overview)), then you can import as `SampleData[Sequences]`. Its a bit of an awkward workflow though, I wonder if there is a better way for you to dereplicate outside of QIIME 2.
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [September 25, 2019, 3:34pm UTC](https://forum.qiime2.org/t/trouble-importing-megahit-assemblies/11648/5 "2019-09-25T15:34:25Z")
Sorry @Nick_D I read too quickly before and now see you already told me that:
> [@Nick\_D](#):
>
> I cannot import them as SampleData[Sequence] (which is the format I actually need to run the qiime vsearch dereplicate-sequences command).
Essentially you are trying to run [this tutorial](https://docs.qiime2.org/2019.7/tutorials/otu-clustering/), except that you have per-sample fasta, whereas the fasta format expected should be in a single file, rather than a directory of per-sample fasta files. So as @thermokarst advised:
> [@thermokarst](#):
>
> You could multiplex all the samples (while modifying the reflines to match the [necessary format](http://qiime.org/documentation/file_formats.html#post-split-libraries-fasta-file-overview)), then you can import as `SampleData[Sequences]`
---
### Author:  [@Nick\_D](https://forum.qiime2.org/u/Nick_D)
#### Post date: [September 26, 2019, 5:35am UTC](https://forum.qiime2.org/t/trouble-importing-megahit-assemblies/11648/6 "2019-09-26T05:35:55Z")
> [@thermokarst](#):
>
> The megahit assemblies are per-sample, right?
> [@Nicholas\_Bokulich](#):
>
> Essentially you are trying to run [this tutorial](https://docs.qiime2.org/2019.7/tutorials/otu-clustering/), except that you have per-sample fasta, whereas the fasta format expected should be in a single file, rather than a directory of per-sample fasta files. So as @thermokarst advised:
Sorry, I don't think I was very clear about the format of the assemblies and it's causing a bit of confusion. I'm trying to import each FASTA file separately rather than as a directory, because they are from different metagenomic samples. Also, each discrete FASTA sample/file has about 50,000 assemblies in it. (See screenshot below)
---
### Author:  [@thermokarst](https://forum.qiime2.org/u/thermokarst)
#### Post date: [September 26, 2019, 1:20pm UTC](https://forum.qiime2.org/t/trouble-importing-megahit-assemblies/11648/7 "2019-09-26T13:20:38Z")
Hey @Nick_D!
> [@Nick\_D](#):
>
> Sorry, I don’t think I was very clear about the format of the assemblies
I disagree, I think you explained it very well!
> [@Nick\_D](#):
>
> it’s causing a bit of confusion
I don't think so, I think @Nicholas_Bokulich & I are on the same page as you (more below).
> [@Nick\_D](#):
>
> they are from different metagenomic samples
This is what we mean by "per-sample assemblies" --- you have one file per sample containing the assembly sequences. As I mentioned above, in order to dereplicate in QIIME 2 you will need to _multiplex_ (which is a step in the reverse direction) before importing and dereplicating.
For what its worth, I think in the future it will make sense for us to create a new import format in q2-types to support this schema.
* * *
## Sample workflow
```bash
cd path/to/fasta/files
touch merged.fasta
for f in *.fasta; do fn="${$(basename -- "$f")%.*}"; sed "s/^>\(.*\)$/>\\$fn\_\1/" $f >> merged.fasta; done
qiime tools import \
--input-path merged.fasta \
--output-path seqs.qza \
--type 'SampleData[Sequences]'
qiime vsearch dereplicate-sequences \
--i-sequences seqs.qza \
--o-dereplicated-table table.qza \
--o-dereplicated-sequences rep-seqs.qza \
--verbose
qiime feature-table summarize \
--i-table table.qza \
--o-visualization table.qzv
```
---
### Author:  [@Nick\_D](https://forum.qiime2.org/u/Nick_D)
#### Post date: [September 27, 2019, 5:41am UTC](https://forum.qiime2.org/t/trouble-importing-megahit-assemblies/11648/8 "2019-09-27T05:41:07Z")
Thank you so much for the help, I really appreciate it! I think I mixed up the terminology and confused myself, I'm glad you guys knew what I was talking about anyway 😅.
I tried the workflow you posted, but when I pasted the code in the terminal it threw this error:
Did I do that correctly?
---
### Author:  [@Nick\_D](https://forum.qiime2.org/u/Nick_D)
#### Post date: [September 30, 2019, 3:39am UTC](https://forum.qiime2.org/t/trouble-importing-megahit-assemblies/11648/9 "2019-09-30T03:39:27Z")
Just in case anyone else runs into the same problem as I did, I found another work-around to get the sequences imported:
1. Download bbtools ([https://jgi.doe.gov/data-and-tools/bbtools/bb-tools-user-guide/reformat-guide/](https://jgi.doe.gov/data-and-tools/bbtools/bb-tools-user-guide/reformat-guide/))
2. Decompress the tool archive.
3. cd to the main tool directory.
4. Drag/Drop reformat.sh into terminal.
5. Type: in='InputFileLocation.fa' out='WhereYouWantTheOutputFile.fasta' fastawrap=10000
6. Done
The "fastawrap=" needs to be set high enough to not word-wrap any sequences in your .fa file.
It's a bit of a clumsy (I'm not a programmer) method to fix the Megahit assemblies so that they import as SampleData[Sequence], but it gets the job done.