Training a new classifier: primer and reference sequence

Hello!

Now I am trying to train my classifier. I downloaded the 13_8 database and I want to use 97%, but I’m not sure which fasta file should be input when using these commands:
qiime tools import
–type ‘FeatureData[Sequence]’
–input-path 85_otus.fasta
–output-path 85_otus.qza

  1. /gg_13_8_otus/rep_set/97_otus.fasta

1111883
GCTGGCGGCGTGCCTAACACATGTAAGTCGAACGGGACTGGGGGCAAC

  1. /gg_13_8_otus/rep_set_aligned/97_otus.fasta

1109237
----------ATTCCGGTT-GA----------

The second question is about this command:
qiime feature-classifier extract-reads
–i-sequences 85_otus.qza
–p-f-primer GTGCCAGCMGCCGCGGTAA
–p-r-primer GGACTACHVGGGTWTCTAAT
–p-trunc-len 120
–o-reads ref-seqs.qza

I asked the person who constructed the sequencing library, but he said they did not use any primers, and the primer sequence seems to be not necessary in Qiime1. Can I train the classifier without primer sequences?

Thank you very much!

Hello everyone:
I asked the sequencing library constructor again, and he told me the primer sequences!! Hope it works. Moreover, I guess I have to use the 97_otus.fasta in /rep_set directory because the other one doesn’t work.

yes, you need to use the unaligned sequences.

Don’t use the 85_otus, there is not enough specificity. That file is only used in the tutorials for the sake of speed. Use the 99_otus instead.

The primer sequences are not necessary here either, but it does improve classification slightly as noted in the tutorial that you are following.

QIIME2 is a whole different animal from QIIME1… so just because something was done a certain way in QIIME1 does not mean that it is the right way to do things. Many things have changed, and all for the better :smile:

Good luck!

1 Like

Thanks for your detailed reply! As you mentioned primer sequences are not necessary in Qiime2, how can I train classifier without primer?
I guess:
qiime tools import
–type ‘FeatureData[Sequence]’
–input-path 97_otus.fasta
–output-path 97_otus.qza

qiime feature-classifier fit-classifier-naive-bayes
–i-reference-reads 97_otus.qza
–i-reference-taxonomy ref-taxonomy.qza
–o-classifier classifier.qza

Is this right?

Another question is that I used my primers to train the classifier, but it output:
Plugin error from feature-classifier:
No matches found
Debug info has been saved to /tmp/qiime2-q2cli-err-vcz7amvb.log

my primer is Illumina 16s Amplicon PCR Primer
–p-f-primer TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG
–p-r-primer GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC \

Are they too long so no matches found? If so, how long should I trim it.
Thank you!

yes

Yes, those are adapter + primer sequences. See here.

1 Like

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.