# Sidle -- extract reads with noncanonical nucleotide
**URL:** https://forum.qiime2.org/t/sidle-extract-reads-with-noncanonical-nucleotide/24479
**Category:** Library Support
**Tags:** feature-classifier, sidle
**Created:** [October 18, 2022, 10:07pm UTC](https://forum.qiime2.org/t/sidle-extract-reads-with-noncanonical-nucleotide/24479 "2022-10-18T22:07:04Z")
**Posts on this page:** 6
**Page:** 1
### Author:  [@jlli2000](https://forum.qiime2.org/u/jlli2000)
#### Post date: [October 18, 2022, 10:07pm UTC](https://forum.qiime2.org/t/sidle-extract-reads-with-noncanonical-nucleotide/24479/1 "2022-10-18T22:07:04Z")
Hello, Justin:
I installed slide and rescript to Qiime.
I tried to use slide to create a seqs,qza with my COI primers. I used Devon O'rourke's bold\_anml\_seqs.qza as input.
My primer set are:
f-primer GGTCAACAAATCATAAAGATATTGG
r-primer CTTATRTTRTTTATICGIGGRAAIGC
Since the slide does not recognize I, I replace it with N.
> --p-f-primer GGTCAACAAATCATAAAGATATTGG
> --p-r-primer CTTATRTTRTTTATNCGNGGRAANGC
and run the following command per slide tutorial:
$ qiime feature-classifier extract-reads
quences \> --i-sequences slide3-bold\_anml\_seqs.qza
--p-f-primer GGTCAACAAATCATAAAGATATTGG
--p-r-primer CTTATRTTRTTTATNCGNGGRAANGC
--o-reads slide3-bold\_anml\_seq-CO1-F230.qza
Plugin error from feature-classifier:
No matches found
Debug info has been saved to /tmp/qiime2-q2cli-err-l1y4\_oa1.log
(qiime2-2022.8) main@BioInfo-1:~/Folder1/bold\_database$
I have two questions:
1. Is it correct to replace base I with base N in the primer sequences
2. Why there is no matches? Do I have too many degenerated bases in primers? How can I solve the problem?
Thanks,
Jin
---
### Author:  [@jwdebelius](https://forum.qiime2.org/u/jwdebelius)
#### Post date: [October 18, 2022, 10:08pm UTC](https://forum.qiime2.org/t/sidle-extract-reads-with-noncanonical-nucleotide/24479/2 "2022-10-18T22:08:37Z")
---
### Author:  [@jwdebelius](https://forum.qiime2.org/u/jwdebelius)
#### Post date: [October 18, 2022, 10:08pm UTC](https://forum.qiime2.org/t/sidle-extract-reads-with-noncanonical-nucleotide/24479/3 "2022-10-18T22:08:44Z")
---
### Author:  [@jwdebelius](https://forum.qiime2.org/u/jwdebelius)
#### Post date: [October 19, 2022, 1:55pm UTC](https://forum.qiime2.org/t/sidle-extract-reads-with-noncanonical-nucleotide/24479/4 "2022-10-19T13:55:28Z")
Hi @jlli2000,
I shared this so everyone can see it. I is not a canonical nucleotide, and as far as I know q2-feature-classifier may not be set up to handle it. (Although you won't be able to build a tree, that step in Sidle won't be able to handle the I.)
There's a conversation about this issue here:
> [@Importing BOLD COI sequence data into QIIME 2 / RESCRIPt](https://forum.qiime2.org/t/importing-bold-coi-sequence-data-into-qiime-2-rescript/15640/46):
>
> Hi @devonorourke, Sorry for the delayed response. Thanks for sharing the details of your awesome sleuthing process! About the primers not always landing where they should... this is the key problem I highlighted [here](https://forum.qiime2.org/t/silva-138-classifiers/13131/37), when it comes to using alignment positions for extraction, see the first bullet. It might be best to make a very small alignment, in which you know the primers will align properly, then start your process of mapping all your other data to this alignment. I've done this before an…
you might also check the BOLD database that's described here that will give you more ideas.
> [@Building a COI database from BOLD references](https://forum.qiime2.org/t/building-a-coi-database-from-bold-references/16129):
>
> construction stop_signconstruction stop_signconstruction stop_signconstruction stop_signconstruction stop_signCitations: If you use the following COI resources or RESCRIPt for COI database preparation, please cite the following: Michael S Robeson II, Devon R O’Rourke, Benjamin D Kaehler, Michal Ziemski, Matthew R Dillon, Jeffrey T Foster, Nicholas A Bokulich. RESCRIPt: Reproducible sequence taxonomy reference database management for the masses. bioRxiv 2020.10.05.326504;…
I'm sorry I dont have any COI experience, so I'm not sure about this particular issue.
Best,
Justine
---
### Author:  [@jwdebelius](https://forum.qiime2.org/u/jwdebelius)
#### Post date: [October 19, 2022, 2:33pm UTC](https://forum.qiime2.org/t/sidle-extract-reads-with-noncanonical-nucleotide/24479/5 "2022-10-19T14:33:02Z")
---
### Author:  [@SoilRotifer](https://forum.qiime2.org/u/SoilRotifer)
#### Post date: [October 19, 2022, 3:51pm UTC](https://forum.qiime2.org/t/sidle-extract-reads-with-noncanonical-nucleotide/24479/6 "2022-10-19T15:51:02Z")
To extend @jwdebelius's response, in particular to the `I` nucleotide.
> [@jlli2000](#):
>
> Is it correct to replace base I with base N in the primer sequences
Yes! In fact you can read one of my old posts here:
> [@Handling ambiguous nucleotides in database construction](https://forum.qiime2.org/t/handling-ambiguous-nucleotides-in-database-construction/8537/4):
>
> Hi @devonorourke & @Nicholas_Bokulich, I have had similar issues with I characters when using vsearch and other similar tools. Keep in mind that I stands for the chemical Inosine / deoxyInosine, which you can order as part of your oligos (e.g. from [IDT](https://www.idtdna.com/pages/support/faqs/does-idt-offer-inosine-(i)-how-do-i-order-oligos-containing-inosine-bases-)). That is, it functions literally as an ambiguous N base. So, wherever you find and I replace with N. For example, take a look at the CO1 blocking primer we made in [our swine diet paper](https://doi.org/10.1002/ece3.3638). As for the U --\> T bit... In the past, when I put that set…
Regarding:
> [@jlli2000](#):
>
> Why there is no matches? Do I have too many degenerated bases in primers? How can I solve the problem?
I do not think you have too many degeneracies. If anything, you'd be more likely to run the risk of extracting more _spurious_ sequences than extracting _less_ sequences. Given that these are the same primers as reviewed in [Porter et al.](https://doi.org/10.1038/s41598-019-54532-0), from [Gibson et al.](https://doi.org/10.1073/pnas.1406468111), [Folmer et al.](https://pubmed.ncbi.nlm.nih.gov/7881515/), I'd think they are fine.
Alternatively, many researchers remove primer sequences prior to submitting to online repositories. For example, if they amplified and sequenced the same region as you, then they most likely removed the primer sequences before doing so. Which is a good thing. However, this means that PCR primer searches will not work to extract a given region.
You can try the [extract-seq-segments](https://forum.qiime2.org/t/using-rescripts-extract-seq-segments-to-extract-reference-sequences-without-pcr-primer-pairs/23618) approach of [RESCRIPt](https://github.com/bokulich-lab/RESCRIPt) to extract your amplicon region from sequences that might be missing the primer sequences.