Question on how to convert demultiplexed data obtained from Illumina sequencing

Hello,

I was wondering how do I convert a demultiplexed data into a mapping file that I can use in QUIIME?

Here is an example of how my data looks like in TextWrangler.

3056G_401 M02997:72:000000000-AW89G:1:1101:13437:1777 1:N:0:1 orig_bc=TTGCCAAGAGTC new_bc=TTGCCAAGAGTC bc_diffs=0
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGTTAAGCGAGATGTGAAAGCCCTGGGCTCAACCTGGGAACTGCATTTCGAACTGGCAGGCTAGAGTACAAGAGAGGGTGGTAGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAATACCAGTGGCGAAGGCGGCCACCTGGCTTGATACTGACGCTGAGGTGCGAAAGCGTGGGGAGCGAACAGG
3056G_850 M02997:72:000000000-AW89G:1:1101:18541:1889 1:N:0:1 orig_bc=TTGCCAAGAGTC new_bc=TTGCCAAGAGTC bc_diffs=0
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGTTAAGCGAGATGTGAAAGCCCTGGGCTCAACCTGGGAACTGCATTTCGAACTGGCAGGCTAGAGTACAAGAGAGGGTGGTAGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAATACCAGTGGCGAAGGCGGCCACCTGGCTTGATACTGACGCTGAGGTGCGAAAGCGTGGGGAGCGAACAGG

Hi @JoanGalarza!

A metadata (“mapping”) file is for providing additional context and information to per-sample reads (or individual features) — that is usually some kind of data very specific to your particular study. For example, QIIME 2 sample metadata might include elapsed time, pH, elevation, surgery status, sample type, age, or body site. Check out the Metadata in QIIME 2 tutorial for suggestions on getting started with metadata. As well, take a peek at the Moving Pictures tutorial, which has a great example of a Sample Metadata file.

As far as importing your demultiplexed reads goes, please check out the Importing data section on Fastq Manifest formats - if your reads are already demultiplexed (per-sample), you can use this import type to get your reads into QIIME 2. Keep us posted and let us know if you have any questions! :t_rex:

1 Like

Thank you for answering my question.

I was able to dowloaded the mapping file and check wether there are errors in it or not.
My question now is how do I download my sequences that have been already demultiplexed into QIIME2? is there an online link that shows one how to this?
and once downloaded, how do I check for chimeras?

Hi @JoanGalarza!

I might be misreading this question, and if so please correct me, but this sounds like you are trying to import data. Please see my post above, there are links I provided to you above that provide references to importing these kinds of data.

Check out the Chimera filtering tutorial!

Before you jump into all of this though, I highly recommend you take a step back and review our Getting Started Guide — we have assembled several tutorials, plus a lot of general-purpose documents that explain how to get up an running with QIIME 2. Thanks! :t_rex:

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.