Hello! I am very new to QIIME2 and am running into an issue with my data.
This is what I have run so far:
qiime tools import \
--type 'SampleData[PairedEndSequencesWithQuality]' \
--input-format PairedEndFastqManifestPhred33V2 \
--input-path manifest.txt \
--output-path demux_seqs.qza
qiime demux summarize \
--i-data demux_seqs.qza \
--o-visualization demux_seqs.qzv
**-- output error "'NoneType' object has no attribute 'strip'"**
I then followed along with other forums that had the same issue and proceeded with running the following to determine the line counts per sequence:
for f in *.fastq; do r=$(( $(wc -l < $f | tr -d '[:space:]') % 4 )); echo $r $f; done
Nine of my fastq files had 1 and one had 2, which I believe means that there is 1 or 2 extra lines when it’s not supposed to, likely to be blank lines (please correct me if I am wrong).
Then for each of these 10 files I ran:
grep -c ’\$’ filename.fastq
However, they all came back with 0 blank lines.
Then, I found that I could run:
qiime tools validate demux_seqs.qza
This came back with:
Result demux_seqs.qza does not appear to be valid at level=max:
/tmp/qiime2-archive-m5btpqhe/9188183d-5361-4334-aca7-2b1bad38803c/data/41029_06_216_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:
Quality score length doesn't match sequence length for record beginning on line 123841
I manually viewed this fastq file in bbedit and this is what I found on line 123841-123845:
@M04632:65:000000000-J8JG5:1:1111:2425:9923 1:N:0:TCTAGACT+ATATACAC
TGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAGAAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGTAATACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCT
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGEFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFFG — followed by many upside-down question marks that wouldn’t paste
To note, these files are all unmodified from the sequencer and I am running this in qiime2-2020.6 in a computing cluster through anaconda2.
I’m at a loss for how to proceed!
Any help would be appreciated, thank you in advance!
Lindsay
