Moving pictures tutorial: Demultiplexing

User Support
5

Hi, @Rania,

Welcome to the :qiime2: forum!

Can you elaborate on what you mean by trying to allocate the barcodes inside the sequences? What exactly did you try? What were the expected results vs actual results?

I think the observations noted below will help clarify some things:

If you compare the sequence identifiers in both sequences.fastq and barcodes.fastq emp-single-end-sequences/sequences.fastq.gz and emp-single-end-sequences/barcodes.fastq.gz from the moving pictures tutorial), you will notice that the identifiers match up. I'll demonstrate this with the command below which simply displays the first entry in both sequences.fastq and barcodes.fastq.

➜ head -n4 sequences.fastq barcodes.fastq
==> sequences.fastq <==
@HWI-EAS440_0386:1:23:17547:1423#0/1
TACGNAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGGGGGGATTGGTGTG
+
IIIE)EEEEEEEEGFIIGIIIHIHHGIIIGIIHHHGIIHGHEGDGIFIGEHGIHHGHHGHHGGHEEGHEGGEHEBBHBBEEDCEDDD>B?BE@@B>@@@@@CB@ABA@@?@@=>?08;3=;==8:5;@6?######################

==> barcodes.fastq <==
@HWI-EAS440_0386:1:23:17547:1423#0/1
ATGCAGCTCAGT
+
IIIIIIIIIIIH

In this case, the identifier @HWI-EAS440_0386:1:23:17547:1423#0/1 appears in both sequences.fastq and barcodes.fastq. Note that you need to unzip the fastq files before you can look at them.

You will also notice a 1-1 correspondence between the sequences in barcodes.fastq and values in the barcode-sequence column of sample-metadata.tsv.

➜ grep ATGCAGCTCAGT qiime2-moving-pictures-tutorial/sample-metadata.tsv
L2S204	ATGCAGCTCAGT	left palm	2009	3	17	subject-1	No	140

I hope this helps! :nerd_face: