ITS data processing using dada2

Hi,

I am wondering if anyone can suggest me if dada2 command is correct for the ITS data processing.

I have run the fastqc to check the adapter sequences and I have found no hit for adapter so I am not trimming the adapter seq. and then after import pair end file to qiime2,
but fastqc report shows a large number of read with NNNNNN…what should I do with these noisy reads?

Overrepresented sequences
Sequence                                           Count    Percentage        Possible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN                 43433   30.947087911304916  No Hit
CTTGGTCATTTATACACATCTCCGAGCCCACGAGACACTGAGCGATCTCG  14690   10.466988727858293  No Hit
CTTGCGTTGAAGATGATGATGCCTATTAGCGGTGGCGGCGACGTGGCCGA  11563   8.238923802602141   No Hit

I have a look on demax.qzv file and I am thinking to use the below command?

demux.qzv (294.9 KB)

dada2 command;

qiime dada2 denoise-paired --i-demultiplexed-seqs demux.qza --o-table table.qza --o-representative-sequences rep-seqs.qza --p-trim-left-f 34 --p-trim-left-r 20 --p-trunc-len-f 0 --p-trunc-len-r 0 --verbose --output-dir dada2_result

I will be thankful for your help and time.
Many thanks
Yogesh

Hi,

I am wondering if anyone can suggest me if dada2 command is correct for the ITS data processing.

I have run the fastqc to check the adapter sequences and I have found no hit for adapter so I am not trimming the adapter seq. and then I import pair end reads to qiime2,
but fastqc report shows a large number of read with NNNNNN…what should I do with these noisy reads?

Overrepresented sequences
Sequence                                           Count    Percentage        Possible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN                 43433   30.947087911304916  No Hit
CTTGGTCATTTATACACATCTCCGAGCCCACGAGACACTGAGCGATCTCG  14690   10.466988727858293  No Hit
CTTGCGTTGAAGATGATGATGCCTATTAGCGGTGGCGGCGACGTGGCCGA  11563   8.238923802602141   No Hit

I have a look on demax.qzv file and I am thinking to use the below command?

demux.qzv (294.9 KB)

dada2 command;

qiime dada2 denoise-paired --i-demultiplexed-seqs demux.qza --o-table table.qza --o-representative-sequences rep-seqs.qza --p-trim-left-f 34 --p-trim-left-r 20 --p-trunc-len-f 0 --p-trunc-len-r 0 --verbose --output-dir dada2_result

I will be thankful for your help and time.
Many thanks
Yogesh

Hi @Yogesh_Gupta!

This seems problematic to me - have you checked with your sequencing center about this? I am wondering if there is a technical error in the sequencing product, or perhaps some kind of pre-processing has been applied?

Let us know what you learn!

:qiime2: