Import paired end sequence with two barcodes

User Support
,
#1

Hi I am new to QIIME2, i have three paired end sequences (demultiplexed)
HP-1-B_R1.fastq, HP-1-B_R2.fastq
PLS-1-C_R1.fastq, PLS-1-C_R2.fastq
SL-2-Diseased_R1.fastq, SL-2-Diseased_R2.fastq

I have checked the sequence in QIIME1 with head n 8 comment it shows two index barcode CTGAAGCT+GGCTCTGA

@700823F:441:HTJ3GBCX2:2:1101:1558:2182 1:N:0:CTGAAGCT+GGCTCTGA

ACTACGGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCATCTGAGTGTCAGTATCTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTTCAGATCTCTACGCATTTCACCGCTACACCTGAAATTCTACCCCCCTCTACAGTACTCTAGTCTGCCAGTTTCAAATGCTATTCCGAGGTTGAGCCCCGGGCTTTCACATCTGACTTAACAAACCACCTGCATGCGCTTTACGCCCAGTAATTCCGA
+
GGGGGIIIIIIIIIIIIIIIIIIIIIGGGGGGGIIGGIIIIIIIIIGGGGGGGGGIIGIIIIGIIGGGGGIIIGIIIIGGGIGIIIGGGIGIIGIIIGGIIAGGGGAGGIIIIIIGIGGGGIIIIGGGGGGIIGGGGIIIIIIIIIIIIIIIGGIGGGGGGGGGIIGIGGAGGGGGAGGGIGGGG.GGGGGGGGGG.GGGGGGGIGIGIIGIIIIGGGGGGGGGGGG7<GGGGGGGGIGGGGGAGGAGAA
@700823F:441:HTJ3GBCX2:2:1101:1537:2235 1:N:0:CTGAAGCT+GGCTCTGA
GACTACGCGGG

I do know how to import the file and how to prepare metadata file for this type of sequence, so can any one help in this regards
Thanks for your valuable time

#2

Hi @kulandai1,

Since you have demultiplexed files already you can simply import them using the manifest import format outlined here.
As for preparing a metadata file (which is different than a manifest file) this is totally dependent on your experiment as these are information regarding your data based on your experiment. You can read all about what a metadata file should be like in this tutorial.

#3

Hi Mehrbod
Thanks for your replay, I had tried the manifest import format it shows error that file is not found, but the file is in the same working directory.
Help me in this regards.
Thank you

#4

Hi @kulandai1,

Are the paths in your manifest file absolute paths? If you try ls with one of the paths does it take you directly to that file?

To troubleshoot we’ll need the exact commands you ran + the full error message you receive, please copy & paste these exactly.

#5

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.