# How to train the classifier with multiple mixed forward primers?
**URL:** https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-mixed-forward-primers/25356
**Category:** User Support
**Tags:** feature-classifier
**Created:** [January 31, 2023, 2:14pm UTC](https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-mixed-forward-primers/25356 "2023-01-31T14:14:19Z")
**Posts on this page:** 6
**Page:** 1
### Author:  [@Birong](https://forum.qiime2.org/u/Birong)
#### Post date: [January 31, 2023, 2:14pm UTC](https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-mixed-forward-primers/25356/1 "2023-01-31T14:14:19Z")
Hi,
I am analysing V1-V2 16S rRNA sequence data. I want to use **qiime feature-classifier extract-reads** to extract reads and train a classifier.
However, this data has mixed primers:
```auto
V1-V2 MiSeq primers (parts in bold are adapter sequences)
Forward: These primers are mixed at a 4:1:1:1 ratio (28F-YM is the 4)
28F-YM: **TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG** GAGTTTGATYMTGGCTCAG
28F-Borrellia: **TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG** GAGTTTGATCCTGGCTTAG
28FChloroflex: **TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG** GAATTTGATCTTGGTTCAG
28F-Bifdo: **TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG** GGGTTCGATTCTGGCTCAG
```
I came across this one: [How to train the classifier with multiple reverse primers?](https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-reverse-primers/3581). but my case has so many differences. But my case seems more complicated. I have primers, and they seem quite different.
What should I do?
Any advices would be highly appreciated! Thanks!
Kind regards,
Birong
---
### Author:  [@crusher083](https://forum.qiime2.org/u/crusher083)
#### Post date: [January 31, 2023, 2:17pm UTC](https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-mixed-forward-primers/25356/2 "2023-01-31T14:17:08Z")
Hello,
Let's start with the same method that was in the linked thread explained in detail by @colinbrislawn - we need a metric to discuss whether primers are different or not.
So please, provide the information on how different these primers are.
Cheers
V
---
### Author:  [@Birong](https://forum.qiime2.org/u/Birong)
#### Post date: [January 31, 2023, 2:51pm UTC](https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-mixed-forward-primers/25356/3 "2023-01-31T14:51:50Z")
Hi V,
Thanks for your kind help.
How about this:
```auto
28F-YM: GAGTTTGATYMTGGCTCAG
28F-Borrellia: GAGTTTGATCCTGGCTTAG
28FChloroflex: GAATTTGATCTTGGTTCAG
28F-Bifdo: GGGTTCGATTCTGGCTCAG
28F-YM vs 28F-Borrellia == 3
28F-YM vs 28FChloroflex == 4
28F-YM vs 28F-Bifdo == 4
28F-Borrellia vs 28FChloroflex == 4
28F-Borrellia vs 28F-Bifdo == 4
28FChloroflex vs 28F-Bifdo == 6
(19-4) differences / 19 bp length == 78.95% similar
--p-identity 0.7/0.8 ？
```
However, another problem is these primers are mixed at a 4:1:1:1 ratio (28F-YM is the 4), how to take this into account? Should I use **28F-YM & --p-identity 0.7/0.8**?
Thank.
---
### Author:  [@SoilRotifer](https://forum.qiime2.org/u/SoilRotifer)
#### Post date: [February 1, 2023, 2:41pm UTC](https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-mixed-forward-primers/25356/4 "2023-02-01T14:41:47Z")
HI @Birong ,
It appears that all of these primers bind to the same location, and only differ by a few bases. You could combine these 4 sequences into a pseudo-sequence using the [IUPAC](https://en.wikipedia.org/wiki/International_Union_of_Pure_and_Applied_Chemistry#Amino_acid_and_nucleotide_base_codes) ambiguity codes like this:
An extreme case would result in something like this:
`GRRTTYGATYMTGGYTYAG`
_^^Warning: This might be too ambiguous and lead to spurious hits._
Since we can allow for a certain amount of mis-matches lets try something like you suggested by slightly lowering the identity, or make a new sequence string, (see below). I retained the initial ambiguous IUPAC bases added additional ones where the common base had a stronger bond, (i.e. a G or a C).
`GARTTTGATYMTGGCTYAG`
_^^This still might be too ambiguous, but you get the idea_
👉 Another option, which I'd recomend, is to use only one of the primer sets. Specifically, the one that uses `28F-YM` primer and use the resulting extracted sequences as a reference pool for guiding the extraction of this region without the use of additional primer pairs. That is, follow the approach outlined [here](https://forum.qiime2.org/t/using-rescripts-extract-seq-segments-to-extract-reference-sequences-without-pcr-primer-pairs/23618).
-Cheers!
-Mike
---
### Author:  [@Birong](https://forum.qiime2.org/u/Birong)
#### Post date: [February 1, 2023, 3:33pm UTC](https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-mixed-forward-primers/25356/5 "2023-02-01T15:33:18Z")
Hi Mike,
Thanks for you reply! Learned a lot! Wii try!
I guess [the last one](https://forum.qiime2.org/t/using-rescripts-extract-seq-segments-to-extract-reference-sequences-without-pcr-primer-pairs/23618) also applies to **qiime rescript get-silva-data** , like this:
```auto
## get-silva-data
qiime rescript get-silva-data \
--p-version '138.1' \
--p-target 'SSURef_NR99' \
--p-include-species-labels \
--o-silva-sequences silva-138-99-seqs.qza \
--o-silva-taxonomy silva-138-99-tax.qza
## Dereplicate
qiime rescript dereplicate \
--i-sequences silva-138-99-seqs.qza \
--i-taxa silva-138-99-tax.qza \
--p-mode 'uniq' \
--p-threads 8 \
--o-dereplicated-sequences silva-138-99-seqs-derep.qza \
--o-dereplicated-taxa silva-138-99-tax-derep.qza
## extract-reads
qiime feature-classifier extract-reads \
--i-sequences silva-138-99-seqs-derep.qza \
--p-f-primer GAGTTTGATYMTGGCTCAG \ #28F-YM
--p-r-primer GCTGCCTCCCGTAGGAGT \ #388R
--p-n-jobs 8 \
--o-reads ilva-138-99-seqs-segments.qza
```
Many thanks!
Birong
---
### Author:  [@system](https://forum.qiime2.org/u/system)
#### Post date: [March 4, 2023, 9:34pm UTC](https://forum.qiime2.org/t/how-to-train-the-classifier-with-multiple-mixed-forward-primers/25356/6 "2023-03-04T21:34:17Z")
This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.