How to merge different qza from "qiime feature-classifier extract-reads" command?

Dear Friends,

I am running this below command to extract reads from green gene database based on the primers. The issue is I have 20 primers; forward and reverse:

GTGCCAGCAGCCGCGGTAA - Forward
GTGCCAGCCGCCGCGGTAA - Forward

Reverse:
GGACTACAAGGGTATCTAAT
GGACTACACGGGTATCTAAT
GGACTACCCGGGTATCTAAT
GGACTACTAGGGTATCTAAT
GGACTACTCGGGTATCTAAT
GGACTACCAGGGTATCTAAT
GGACTACAGGGGTATCTAAT
GGACTACACGGGTTTCTAAT
GGACTACAAGGGTTTCTAAT
GGACTACTGGGGTATCTAAT
GGACTACCCGGGTTTCTAAT
GGACTACCGGGGTATCTAAT
GGACTACTCGGGTTTCTAAT
GGACTACTAGGGTTTCTAAT
GGACTACAGGGGTTTCTAAT
GGACTACCAGGGTTTCTAAT
GGACTACTGGGGTTTCTAAT
GGACTACCGGGGTTTCTAAT

I have to run this command: (to extract reference sequences from green gene database)

qiime feature-classifier extract-reads --i-sequences gg_13_5.qza --p-f-primer FORWARDPRIMER --p-r-primer REVERSEPRIMER --o-reads gg_13_5_ww_DNA_1to11_paired_ref_seq.qza --verbose

Can you please let me know how to do this step using all the primers I have? Thanks!

@danielsebas,
What you really want to do here is merge your primer sequences into one forward and one reverse primer, and designate degenerate bases for the variable sites; because your primers are really variations on the same primer. Then run this command with those degenerate primer sequences.

Good luck!

Thank you @Nicholas_Bokulich. I do not follow what exactly you mean, could you please try to explain by an example from the data I have put; I would really appreciate. Thank you!

https://www.bioinformatics.org/sms2/iupac.html

Thanks @Nicholas_Bokulich. Do you mean to do this:

GGA CTA CNV GGG TWT CTA AT - reverse
GTG YCA GCM GCC GCG GTA A - forward

qiime feature-classifier extract-reads --i-sequences gg_13_5.qza --p-f-primer GTGYCAGCMGCCGCGGTAA --p-r-primer GGACTACNVGGGTWTCTAAT --o-reads gg_13_5_ww_DNA_1to11_paired_ref_seq.qza --verbose

Does Qiime recognize these primers with degenerate bases? Thanks!

Yes and yes! Good luck! :smile:

1 Like

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.