feature ID`
if the feature ID is the taxonomic label.
The ideal situation though is to figure out that lineage information; and ideally that information already exists in the fasta header of your file. E.g., many sequences from NCBI have descriptions as part of the header line, which may include taxonomic info like this:
```auto
A82902A Description of sequence | now;maybe;some;taxonomy;information?
AGCTTGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCAGTCGATCGTAGC
```
In which case you could transform that file to create a separate taxonomy file that looks like this:
`A82902A now;maybe;some;taxonomy;information`
You can also look at the "data resources" page at [qiime2.org](http://qiime2.org) to see some examples (look at the Greengenes and SILVA reference databases and not the pre-trained classifiers)
Good luck!
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [March 10, 2020, 10:52pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/9 "2020-03-10T22:52:30Z")
---
### Author:  [@EGvibrio](https://forum.qiime2.org/u/EGvibrio)
#### Post date: [March 19, 2020, 4:01pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/10 "2020-03-19T16:01:10Z")
Hi everybody,
In the end, I managed to create a classifier with table that i had created myself.
However, now, I am trying to classify with the sklearn method. first, I got an error message that the classifier does not support confidence values. I disabled it:
qiime feature-classifier classify-sklearn
--i-reads rep-seqs-dada2.qza
--i-classifier classifier2017.qza
--p-confidence disable
--o-classification taxonomy\_2017.qza
and still it says that it does not support.
I am also attaching a debug file (I am using QIIME 2 2019.10).
Thanks and stay healthy.
Traceback (most recent call last):
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/q2cli/commands.py", line 328, in **call**
results = action(\*\*arguments)
File "\", line 2, in classify\_sklearn
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/qiime2/sdk/action.py", line 240, in bound\_callable
output\_types, provenance)
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/qiime2/sdk/action.py", line 383, in _callable\_executor_
output\_views = self.\_callable(\*\*view\_args)
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/q2\_feature\_classifier/classifier.py", line 215, in classify\_sklearn
reads, classifier, read\_orientation=read\_orientation)
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/q2\_feature\_classifier/classifier.py", line 170, in \_autodetect\_orientation
result = list(zip(\*predict(first\_n\_reads, classifier, confidence=0.)))
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/q2\_feature\_classifier/\_skl.py", line 45, in predict
for chunk in \_chunks(reads, chunk\_size)) for m in c)
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/joblib/parallel.py", line 1003, in **call**
if self.dispatch\_one\_batch(iterator):
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/joblib/parallel.py", line 834, in dispatch\_one\_batch
self.\_dispatch(tasks)
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/joblib/parallel.py", line 753, in \_dispatch
job = self.\_backend.apply\_async(batch, callback=cb)
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/joblib/\_parallel\_backends.py", line 201, in apply\_async
result = ImmediateResult(func)
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/joblib/\_parallel\_backends.py", line 582, in **init**
self.results = batch()
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/joblib/parallel.py", line 256, in **call**
for func, args, kwargs in self.items]
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/joblib/parallel.py", line 256, in
for func, args, kwargs in self.items]
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/q2\_feature\_classifier/\_skl.py", line 52, in \_predict\_chunk
return \_predict\_chunk\_with\_conf(pipeline, separator, confidence, chunk)
File "/home/qiime2/miniconda/envs/qiime2-2019.10/lib/python3.6/site-packages/q2\_feature\_classifier/\_skl.py", line 68, in \_predict\_chunk\_with\_conf
raise ValueError('this classifier does not support confidence values')
ValueError: this classifier does not support confidence values
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [March 19, 2020, 4:20pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/11 "2020-03-19T16:20:49Z")
Hi @EGvibrio,
> [@EGvibrio](#):
>
> In the end, I managed to create a classifier with table that i had created myself
🥳
> [@EGvibrio](#):
>
> However, now, I am trying to classify with the sklearn method. first, I got an error message that the classifier does not support confidence values
As I think you've probably read elsewhere on the forum, this is because your custom taxonomy file contains uneven ranks. If it is at all possible to create even taxonomic ranks (i.e., same number of semicolon-delimited levels in each reference taxonomy label), this would be the "best" way to address this, if potentially more time-consuming (best because then you can classify with confidence, instead of just finding the top hit).
confidence=disable is the quick way to address this, and should work... so the fact that you get this error is a bit concerning (possible bug). So let's troubleshoot a little bit. Could you do the following:
1. Could you please install and run with version 2020.2? We will need to work off of the latest release to debug, just to make sure this is not an issue with an outdated release.
2. Use the `--p-read-orientation` to set the read orientation of your query sequences relative to your reference sequences. If this runs, I've figured out where the bug is creeping in.
Thanks for reporting!
---
### Author:  [@EGvibrio](https://forum.qiime2.org/u/EGvibrio)
#### Post date: [March 21, 2020, 2:48pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/12 "2020-03-21T14:48:43Z")
Thank you for your help.
I downloaded a newer version 2020.2, still it does not work. I also have set the read orientation i got an error message:
> index 1 is out of bounds for axis 0 with size 1
and here is the debug:
> Traceback (most recent call last):
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/q2cli/commands.py", line 328, in **call**
> results = action(\*\*arguments)
> File "\", line 2, in classify\_sklearn
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/qiime2/sdk/action.py", line 245, in bound\_callable
> output\_types, provenance)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/qiime2/sdk/action.py", line 390, in _callable\_executor_
> output\_views = self.\_callable(\*\*view\_args)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/q2\_feature\_classifier/classifier.py", line 220, in classify\_sklearn
> seq\_ids, taxonomy, confidence = list(zip(\*predictions))
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/q2\_feature\_classifier/\_skl.py", line 46, in predict
> for calculated in workers(jobs):
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/joblib/parallel.py", line 1004, in **call**
> if self.dispatch\_one\_batch(iterator):
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/joblib/parallel.py", line 835, in dispatch\_one\_batch
> self.\_dispatch(tasks)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/joblib/parallel.py", line 754, in \_dispatch
> job = self.\_backend.apply\_async(batch, callback=cb)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/joblib/\_parallel\_backends.py", line 209, in apply\_async
> result = ImmediateResult(func)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/joblib/\_parallel\_backends.py", line 590, in **init**
> self.results = batch()
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/joblib/parallel.py", line 256, in **call**
> for func, args, kwargs in self.items]
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/joblib/parallel.py", line 256, in
> for func, args, kwargs in self.items]
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/q2\_feature\_classifier/\_skl.py", line 52, in \_predict\_chunk
> return \_predict\_chunk\_without\_conf(pipeline, chunk)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/q2\_feature\_classifier/\_skl.py", line 59, in _predict\_chunk\_without\_conf
> y = pipeline.predict(X)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/sklearn/utils/metaestimators.py", line 116, in
> out = lambda \*args, \*\*kwargs: self.fn(obj, \*args, \*\*kwargs)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/sklearn/pipeline.py", line 420, in predict
> return self.steps[-1][-1].predict(Xt, \*\*predict\_params)
> File "/home/qiime2/miniconda/envs/qiime2-2020.2/lib/python3.6/site-packages/sklearn/naive\_bayes.py", line 78, in predict
> return self.classes_[np.argmax(jll, axis=1)]
> IndexError: index 1 is out of bounds for axis 0 with size 1
Is there other classifier i should try? or how do i fix it?
Thank you, I really appreciate that.
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [March 21, 2020, 3:55pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/13 "2020-03-21T15:55:43Z")
Hi @EGvibrio,
So this is progress; it looks like setting the read orientation is letting you pass to the next step, but now I _think_ the issue appears to be with the query sequences, not the reference database.
The error message seems to imply that one or more of your query sequences are missing. What are the lengths of these sequences? How many are there? Could you run `qiime feature-table tabulate-seqs` and share the result? (you can send directly to me if you don't want to share publicly)
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [March 22, 2020, 3:47pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/14 "2020-03-22T15:47:44Z")
Hi @EGvibrio,
Thanks for sending your QZV. Nothing looks out of the ordinary with your query sequences!
So now we are back to the original issue: formatting issues with the reference database are most likely to blame. Formatting these files to specification can be a challenging job! If you want to send me your reference sequences and taxonomy I can take a look at those and try to replicate this error...
However, to get moving ahead with your analysis **I recommend using classify-consensus-vsearch instead**. If you are disabling the confidence estimation with `classify-sklearn` then you sort of negate some of the benefits of using that method, and the method will just grab the top hit as the result. At that point, you may as well use `classify-consensus-vsearch --p-maxhits 1` to just do top-hit alignment. If that method raises an error, then it is good indication that there are serious formatting issues with the reference database, causing issues with both classification methods.
---
### Author:  [@EGvibrio](https://forum.qiime2.org/u/EGvibrio)
#### Post date: [March 23, 2020, 8:43am UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/15 "2020-03-23T08:43:19Z")
Hi @Nicholas_Bokulich
Thank you. I downloaded a reference database that did not come with the taxonomy table. I re-organized the fasta file and copied the names of sequences to the text file. I think the problem came from the text file. I will send you the files. Thank you.
---
### Author:  [@thermokarst](https://forum.qiime2.org/u/thermokarst)
#### Post date: [March 24, 2020, 2:44pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/17 "2020-03-24T14:44:02Z")
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [March 26, 2020, 2:59pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/18 "2020-03-26T14:59:29Z")
Just an update for anyone reading: the problem appears to have been caused by formatting issues in the taxonomic database, specifically that the taxonomic labels (not IDs) consisted of integer values.
@EGvibrio please follow up if you confirm that replacing these integers fixes the problem, or if you have any more issues or questions. Thanks!
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [March 26, 2020, 2:59pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/19 "2020-03-26T14:59:31Z")
---
### Author:  [@EGvibrio](https://forum.qiime2.org/u/EGvibrio)
#### Post date: [April 4, 2020, 6:10am UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/20 "2020-04-04T06:10:45Z")
Thank you @Nicholas_Bokulich.
I finally created a taxnomic table by changing integers as you suggested. Thanks and I hope I will share with you my results soon.
Stay safe
---
### Author:  [@system](https://forum.qiime2.org/u/system)
#### Post date: [May 5, 2020, 12:10pm UTC](https://forum.qiime2.org/t/how-do-i-create-a-taxonomic-table-from-fasta-file/13900/21 "2020-05-05T12:10:49Z")
This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.