# GTDB classifer building and training
**URL:** https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173
**Category:** User Support
**Created:** [October 26, 2021, 3:51pm UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173 "2021-10-26T15:51:19Z")
**Posts on this page:** 10
**Page:** 1
### Author:  [@Kapaiden](https://forum.qiime2.org/u/Kapaiden)
#### Post date: [October 26, 2021, 3:51pm UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/1 "2021-10-26T15:51:19Z")
Dear QIIME2 community,
I would like to use the GTDB database for a 16S microbotia analysis. I downloaded the ssu\_all\_r202 file, imported it in qiime2 and extracted the V3V4 regions of the reads. I downloaded the ar122\_taxonomy\_r202 and the bac120\_taxonomy\_r202 files, merged them and then imported the output in qiime2. When I ran the qiime feature-classifier fit-classifier-naive-bayes command I got the error that "not enough values to unpack (expected 2, got 0)". This is obvious since the ID of the sequences aren't the same that the ID in the taxonomy file:
> RS\_GCF\_001571485.1~NZ\_LPTV01000250.1 d\_\_Bacteria;p\_\_Proteobacteria;c\_\_Gammaproteobacteria;o\_\_Enterobacterales;f\_\_Enterobacteriaceae;g\_\_Escherichia;s\_\_Escherichia flexneri [location=183..1721] [ssu\_len=1538] [contig\_len=5037]
> TGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTCGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAA
"RS\_GCF\_014075335.1" "d\_\_Bacteria; p\_\_Proteobacteria; c\_\_Gammaproteobacteria; o\_\_Enterobacterales; f\_\_Enterobacteriaceae; g\_\_Escherichia; s\_\_Escherichia flexneri"
I can suppress all the data after the "~" sign in the sequence ID but some ID become not unique.
As Nicholas\_Bokulich said in an answer to another post that "GTDB works well with QIIME 2, the files are already in an appropriate format" I assume that I miss something but I don't really know what.
The tutorial "Training feature classifiers with q2-feature-classifier" was so helpful for me that I wish the same with the GTDB or even the SILVA database! 🙂
Some help would be appreciated!
---
### Author:  [@jwdebelius](https://forum.qiime2.org/u/jwdebelius)
#### Post date: [October 28, 2021, 7:48am UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/4 "2021-10-28T07:48:26Z")
---
### Author:  [@jwdebelius](https://forum.qiime2.org/u/jwdebelius)
#### Post date: [October 28, 2021, 8:38am UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/5 "2021-10-28T08:38:32Z")
Hi @Kapaiden,
Welcome to the :qiime2: forum!
I have good news and bad news. The GTDB files at r89 and before are formatted to work with QIIME 2. (There may still be tree issues, but let's burn building the classifier first.) It looks like the later versions don't have that specific set up. I've been working with r89 as a reference database for metagenomic annotation and it works pretty well for my fecal samples, but I am also limited by resources issues. So, I think my first suggestion would be to switch to r89.
Once you get the sequences imported, you can follow the [training a feature classifier](https://docs.qiime2.org/2021.8/tutorials/feature-classifier/) tutorial. If you're interested in Silva, you might want to explore the [RESCRIPt](https://forum.qiime2.org/t/processing-filtering-and-evaluating-the-silva-database-and-other-reference-sequence-data-with-rescript/15494) tutorial for Silva specifically.
Best,
Justine
---
### Author:  [@jwdebelius](https://forum.qiime2.org/u/jwdebelius)
#### Post date: [October 28, 2021, 8:38am UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/6 "2021-10-28T08:38:42Z")
---
### Author:  [@Kapaiden](https://forum.qiime2.org/u/Kapaiden)
#### Post date: [October 28, 2021, 10:30am UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/7 "2021-10-28T10:30:16Z")
Thank you for this clear answer! So I will switch to SILVA with RESCRIPt. Thank you again!
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [October 28, 2021, 3:31pm UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/8 "2021-10-28T15:31:13Z")
Hi @Kapaiden ,
> [@Kapaiden](#):
>
> So I will switch to SILVA with RESCRIPt
This may be a better/easier solution overall!
But you got me curious about this, and concerned that GTDB is suddenly not compatible. So I tested and as far as I can tell the current GTDB release is still compatible. Training the classifier (code below) works for me but I have not attempted to test classification.
I think your error message probably relates to this part of your workflow...
> [@Kapaiden](#):
>
> I downloaded the ar122\_taxonomy\_r202 and the bac120\_taxonomy\_r202 files, merged them and then imported the output in qiime2.
when merging you might be introducing a formatting error (e.g., you concatenate files and they are not separated by a line break, or introduce a blank line).
This error message is consistent with such a formatting issue:
> [@Kapaiden](#):
>
> "not enough values to unpack (expected 2, got 0)"
This code works:
```auto
qiime tools import \
--type 'FeatureData[Sequence]' \
--input-path bac120_ssu_reps_r202.fna \
--output-path bac120_ssu_reps_r202.qza
qiime tools import --type 'FeatureData[Taxonomy]' \
--input-path bac120_taxonomy_r202.tsv \
--output-path bac120_taxonomy_r202.qza \
--input-format HeaderlessTSVTaxonomyFormat
qiime feature-classifier fit-classifier-naive-bayes \
--i-reference-reads bac120_ssu_reps_r202.qza \
--i-reference-taxonomy bac120_taxonomy_r202.qza \
--o-classifier bac120_classifier_r202_q2-2021.8.qza
```
---
### Author:  [@Kapaiden](https://forum.qiime2.org/u/Kapaiden)
#### Post date: [November 3, 2021, 1:14pm UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/9 "2021-11-03T13:14:30Z")
Dear all,
the answer of Nicholas\_Bokulich gave me the solution : I merged the ar122\_ssu\_reps\_r202.fna and the bac120\_ssu\_reps\_r202.fna files for the sequences (instead of using the ssu\_all\_r202.fna file) and still used the fusion of the ar122\_taxonomy\_r202 and the bac120\_taxonomy\_r202 files for the taxonomy. The building of the classifier with these 2 resulting files worked ! Now I am happy that I could compare the data obtained with SILVA or GTDB database 🙂 .
Thank you for help.
---
### Author:  [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [November 3, 2021, 4:54pm UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/10 "2021-11-03T16:54:56Z")
Hi @Kapaiden ,
Any chance you could share your solution (code)? This will help others follow in your footsteps instead of the partial solution that I posted.
We plan to add GTDB support in RESCRIPt some day, so when that day comes it will be even easier to auto-format the GTDB database for use with QIIME 2.
Thanks!
---
### Author:  [@Kapaiden](https://forum.qiime2.org/u/Kapaiden)
#### Post date: [November 17, 2021, 3:33pm UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/11 "2021-11-17T15:33:20Z")
Dear all,
here is the code I used to build the classifier. However it may be improved by adding a quality filtering step for example. Any suggestions are welcome.
```auto
cat ar122_ssu_reps_r202.fna bac120_ssu_reps_r202.fna > full_seq_GTDB_r202.fna
cat ar122_taxonomy_r202.tsv bac120_taxonomy_r202.tsv > full_taxonomy_r202.tsv
qiime tools import \
--type 'FeatureData[Sequence]' \
--input-path full_seq_GTDB_r202.fna \
--output-path full_seq_GTDB_r202.qza
qiime tools import \
--type 'FeatureData[Taxonomy]' \
--input-path full_taxonomy_r202.tsv \
--output-path full_taxonomy_r202.qza \
--input-format HeaderlessTSVTaxonomyFormat
qiime feature-classifier extract-reads \
--i-sequences full_seq_GTDB_r202.qza \
--p-f-primer CCTACGGGNGGCWGCAG \
--p-r-primer GGACTACHVGGGTWTCTAAT \
--p-n-jobs 2 \
--p-read-orientation 'forward' \
--o-reads V3V4_GTDB_r202.qza
qiime feature-classifier fit-classifier-naive-bayes \
--i-reference-reads V3V4_GTDB_r202.qza \
--i-reference-taxonomy full_taxonomy_r202.qza \
--o-classifier GTDBclassifierV3V4.qza
```
---
### Author:  [@system](https://forum.qiime2.org/u/system)
#### Post date: [December 18, 2021, 9:34pm UTC](https://forum.qiime2.org/t/gtdb-classifer-building-and-training/21173/12 "2021-12-18T21:34:13Z")
This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.