qiime2 2019.1 on VM Version 5.2.26. I'm creating a representative sequence FASTA file in R from a dada2 feature table. uniquesToFasta(seqtab.nochim, fout='rep-seqs.fna') This gives me a FASTA file such as: >sq1;size=9172; GGAATCGGGATTTCTCATTTCCTGACTAGGGTGATTCTGTCAGCGGTTGATGAATCATTTCACACTCTCTGCT…

Hey @Mehrbod_Estaki , Nice cryptic issue. The problem is that your fasta file has CRLF (windows-style) line endings, most importantly at the ends of the fasta header lines. VSEARCH is interpreting these to be part of the sample ids, and so the vsearch alignment report gets FUBAR... sample ids and al…

QIIME 2 Forum

Exclude-seqs error with imported FASTA file

Technical Support

exclude-seqs

show post in topic

Home
Categories
Guidelines
Terms of Service
Privacy Policy

Powered by Discourse, best viewed with JavaScript enabled