Thank you for the reply again. The a diverity can be helpful in single sample to specify the number of genera found. The metadata clearly asks for the barcodes and primers, Or did I understand it wrong? This is my metadata:
| #SampleID | BarcodeSequence | LinkerPrimerSequence | BodySite | Year | Month | Day | Subject | ReportedAntibioticUsage | DaysSinceExperimentStart | Description |
|---|---|---|---|---|---|---|---|---|---|---|
| #q2:types | categorical | categorical | categorical | numeric | numeric | numeric | categorical | categorical | numeric | categorical |
| C10 | CCATCTCATCCCTGCGTGTCTCCGACTCAGTTCGTGATTCGAT | CYIACTGCTGCCTCCCGTAG | saliva | 2018 | 10 | 28 | subject-1 | Yes | 0 | subject-1.saliva.2008-10-28 |
| L1S57 | CCTCTCTATGGGCAGTCGGTGAT | AGAGTTTGATCMTGGCTCAG | saliva | 2018 | 1 | 20 | subject-1 | No | 84 | subject-1.saliva.2009-1-20 |
My main confusion is if the metadata is asking for barcodes and primers, how dooes that relate to my fastq file. the two primers have different barcode+primer, but are in a single fast q file. If I name both above C10 and L1S57 as 16s.fastq, it says both cant have a same name.
Besides my fastq has no barcode, those were removed by the ion torrent server.The primer were removed as well by cutadapt.
Honestly, I only need the taxa, I'm not even sure why I'm involved in these, If I dont need metadata for the taxa classification I think I will move on.
Regards
Kinaoosh