Hello,
I am using Cutadapt 1.16 with QIIME 2 version 2018.4.
I am demultiplexing a data set with 6 different amplicons barcoded from 47 different templates. I am expecting ~2000 reads per barcode/primer combination. I am using the barcode and primer sequence together as the barcode for demultiplexing which works well except that the first sample analyzed–and I’ve re-ordered them and it’s always whichever one is listed first in the metadata file–winds up with a huge number of reads, way more than expected. All the extraneous ones seem be reads with 3 bases removed. Any help would be greatly appreciated.
Thanks!
(qiime2-2018.4) qiime2@qiime2core2018-4:~$ qiime cutadapt demux-single --i-seqs multiplexed-seqs.qza --m-barcodes-file metadata2.tsv --m-barcodes-column BarcodeSequence --p-error-rate 0 --o-per-sample-sequences demultiplexed-seqs.qza --o-untrimmed-sequences untrimmed.qza --verbose
Running external command line application. This may print messages to stdout and/or stderr.
The command being run is below. This command cannot be manually re-run as it will depend on temporary files that no longer exist.
Command: cutadapt --front file:/tmp/tmpt85v7l8r --error-rate 0.0 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-i_po3nqz/{name}.1.fastq.gz --untrimmed-output /tmp/q2-MultiplexedSingleEndBarcodeInSequenceDirFmt-5qgb1s72/forward.fastq.gz /tmp/qiime2-archive-ip70iw2x/72148ae6-d0f2-49f0-81ec-4fa1bd2eee5e/data/forward.fastq.gz
This is cutadapt 1.16 with Python 3.5.5
Command line parameters: --front file:/tmp/tmpt85v7l8r --error-rate 0.0 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-i_po3nqz/{name}.1.fastq.gz --untrimmed-output /tmp/q2-MultiplexedSingleEndBarcodeInSequenceDirFmt-5qgb1s72/forward.fastq.gz /tmp/qiime2-archive-ip70iw2x/72148ae6-d0f2-49f0-81ec-4fa1bd2eee5e/data/forward.fastq.gz
Running on 1 core
Trimming 47 adapters with at most 0.0% errors in single-end mode …
Finished in 786.25 s (283 us/read; 0.21 M reads/minute).
=== Summary ===
Total reads processed: 2,778,271
Reads with adapters: 236,990 (8.5%)
Reads written (passing filters): 2,778,271 (100.0%)
Total basepairs processed: 581,744,202 bp
Total written (filtered): 578,255,648 bp (99.4%)
=== Adapter ATCC ===
Sequence: CTAAGGTAACGATGGCGGACGGGTGAGTAA; Type: regular 5’; Length: 30; Trimmed: 136588 times.
No. of allowed errors:
0-30 bp: 0
Overview of removed sequences
length count expect max.err error counts
3 135131 43410.5 0 135131
4 133 10852.6 0 133
5 4 2713.2 0 4
16 4 0.0 0 4
17 13 0.0 0 13
18 9 0.0 0 9
19 2 0.0 0 2
28 1 0.0 0 1
29 1 0.0 0 1
30 1289 0.0 0 1289
31 1 0.0 0 1
=== Adapter 14 ===
Sequence: AAGAGGATTCGATGGCGGACGGGTGAGTAA; Type: regular 5’; Length: 30; Trimmed: 3719 times.
No. of allowed errors:
0-30 bp: 0
Overview of removed sequences
length count expect max.err error counts
29 26 0.0 0 26
30 3685 0.0 0 3685
31 7 0.0 0 7
48 1 0.0 0 1
=== Adapter 18 ===
Sequence: TACCAAGATCGATGGCGGACGGGTGAGTAA; Type: regular 5’; Length: 30; Trimmed: 1539 times.
No. of allowed errors:
0-30 bp: 0
Overview of removed sequences
length count expect max.err error counts
26 1 0.0 0 1
28 1 0.0 0 1
29 4 0.0 0 4
30 1530 0.0 0 1530
31 3 0.0 0 3
=== Adapter 21 ===
Sequence: CAGAAGGAACGATGGCGGACGGGTGAGTAA; Type: regular 5’; Length: 30; Trimmed: 1437 times.
No. of allowed errors:
0-30 bp: 0
Overview of removed sequences
length count expect max.err error counts
29 7 0.0 0 7
30 1429 0.0 0 1429
31 1 0.0 0 1
