I have found bits and pieces of my question answered across different discussions, but nothing that completes the picture. I have 4 different sequencing runs that I would like to merge later on. These are from different time periods, and while most are 150 bp pe reads, one of the runs (the oldest) was only done as 100 bp pe reads. All runs used the same primers targeting the 18S v9 region (the 100 bp pe run, just barely covers it with enough overlap to merge).
Previously, I had not truncated the 100bp run during Dada2 at all, in order to get the most reads to merge, conversely, I HAD been truncating the 150 bp runs (and differently, at that!). However, I just read that in order to merge runs downstream, they should all be trimmed/truncated exactly the same. This is probably doable for all the 150 bp runs, but not for the 100 bp run.
I'm trying to figure out a way to include all 4, I'm not sure if it makes more sense to not truncate any of the runs, or if there would be a way to truncate the 150 base pair to make the same length as 100 bp? However, I also read this is less important when you are using pe reads, is this true? In the Gut-to-Soil tutorial, it uses pe reads, but still trims/truncates the same, so maybe this is not the case.
My goal is to be able to compare ASVs between all 4 and not have different unique ASVs generated due to sequence length differences.
This is correct, though perhaps I should explain why:
You can only merge ASVs if they are the same: ASV1: AAATTTAGGATTAGGATGGGATTGCTGATGC ASV2: AAATTTAGGATTAGGATGGGATTGCTGATGCC <- see, it's got an extra C
While these sequences are the same in the area of overlap, the extra basepair prevents merging.
If you work only with the reads that joined, then you can be confident these reads capture the full 18S v9 region of your amplicon. This means they should match exactly and can be merged.
There's no better test then to try it!
Pull the top ASVs from all 4 studies, toss them into an online MSA, and see how well they line up!
If the ASVs match exactly, they can merge! If there's an overhang of a few extra base pairs from the 150 bp read, then they will not merge... until you trim them so they do match exactly!
Yes, I understand why they need to be trimmed and truncated the same, I followed the official tutorial on merging the sequencing runs, I just wasn't sure the best way to go about it given my difference in read lengths.
This is exactly what I was having trouble figuring out- so thank you! I was getting ASVs shared between al sites, so I had a feeling something like this might be the case, but since the instructions said they had to be truncated the same, I wanted to make sure sure before I started writing up my results. I will double check with an MSA though- thanks for the suggestion!