thinesh
(Thinesh Thangadurai)
April 29, 2022, 3:18am
#1
My merging reads are not enough to go to downstream analysis with my 23s samples.
so wanted to test the best trimming option. but, the uneven nature of sequence length is not allowed to carry out the function.
Is there any plugin available to make my FAR & REV the same length with qiime.
Thank.
Hello @thinesh ,
Welcome to the forums!
Would you be willing to post .qzv output from qiime demux summarize
? That will tell us both the quality and read length distribution of your 23S samples, so we can see that trimming options could work well for you.
Also, what primers did you use to amplify the 23S region and how long do you expect your amplicons to be? This will let us calculate expected overlap, which is also helpful.
thinesh
(Thinesh Thangadurai)
May 3, 2022, 1:13pm
#3
Dear Colin,
Thank you very much for your reply. Apologies for the late reply.
see the attached Demux.qzv.
(upload://rASbTB2XFaey6yxyn1bRECzS7bu.png)
https://view.qiime2.org/visualization/?type=html&src=bf384426-d664-4133-9eaf-415d6469511f
our primer as follows and expected 480 bp.
F- AATAACGACCTGCATGAAAC - 20
R- GCCTGTTATCCGTAGAGTAGC -21.
We are thinking of doing concatenation and following trimming. requires timing and learning new comment.
looking forward your suggestion to carry out this work with QIIMe.
Thanks.
Hello @thinesh ,
Thanks!
Could you upload that file as an attachment? (The links are only viewable on your machine, so you have to share the .qzv file, not the link.)
thinesh
(Thinesh Thangadurai)
May 4, 2022, 1:18pm
#5
demux_seqs.qzv (318.4 KB)
demux_seqs.qzv (318.4 KB)
find the attached. Looking forward your suggestion.
Thanks.
1 Like
thinesh
(Thinesh Thangadurai)
May 8, 2022, 3:48am
#6
Dear Colin,
Appreciate you kindly having a look and suggest me the future direction. Thanks.
OK, so...
You have 600 bp of coverage for a 480 gp amplicon. This means your area of overlap should be 120 bp of overlap without any trimming.
The bad news is that the quality drops at the end of R1 and drop a lot at the end of R2, so trimming will be required to get these to merge.
Try these dada2 settings:
--p-trunc-len-f 280
--p-trunc-len-r 220
Trimming locations in red , overlapping area to join in blue :
This gives you 500 bp total, which means you have 20 bp overlap on your 480 bp read. Hopefully this removes enough low quality bases so they can merge, but it may be a challenge given the quality on R2.
EDIT: Also, you posted the same file twice. Do you have a second file you would like me to look at?
1 Like
thinesh
(Thinesh Thangadurai)
May 10, 2022, 5:50am
#8
Dear Colin,
Thanks for your suggestion.
I tried as per your suggestion following the script.
qiime dada2 denoise-paired
--i-demultiplexed-seqs demux2_seqs.qza
--p-trunc-len-f 280
--p-trunc-len-r 220
--o-table table27.qza
--o-representative-sequences rep-seqs27.qza
--o-denoising-stats denoising-stats27.qza
As you mentioned, I did not get good result for many of my samples. I tried this combination also since i wanted to remove primer from the sequences.
qiime dada2 denoise-paired
--i-demultiplexed-seqs demux2_seqs.qza
--p-trim-left-f 20
--p-trim-left-r 21
--p-trunc-len-f 280
--p-trunc-len-r 220
--o-table table27.qza
--o-representative-sequences rep-seqs27.qza
--o-denoising-stats denoising-stats27.qza
What would be your next best option to get good result for my samples.
can i use alternative method for Alternative methods of read-joining in QIIME 2. [(Alternative methods of read-joining in QIIME 2 — QIIME 2 2022.2.0 documentation ).
Looking forward your suggestion.
Thanks.
Nice!
Worth a try!
Keep trying other truncating settings and joining programs.
It's possible that your amplicon is so long and the quality so low that the reads on this run will be impossible to join. This is one of the problems with long amplicons. In that case, you could consider importing only your forward read (because it has the best quality) and running dada2 denoise-single .
Let us know what you try next and what works for you.
thinesh
(Thinesh Thangadurai)
May 11, 2022, 7:30am
#10
Dear Colin,
Thanks for your suggestion.
As i mentioned i tried to do the alternative method. Since my sample is 23s i think i could not run this command (qiime deblur denoise-16S).
I tried different combination as per your suggestion but i loss around 80 samples out of 155 samples. ( file attached)
denoising-stats26.qzv (1.2 MB)
Me and my collaborators are worrying about the diversity loss if we use only use forward sequences.
We are thinking of using concatenation method to use the maximum sequences as possible.
Is there any option available to concatenate samples in QIIME?
Thanks.
thinesh
(Thinesh Thangadurai)
May 17, 2022, 7:22am
#11
Dear Colin,
My question is regarding sampling depth.
Have merged sequences from 1800-100. and few of them are 0.
What would be the ideal merged sequence depth i could select to carryout further analysis.
Regards.
metadata (1).tsv (11.0 KB)