# cutadapt in qiime2-2022.11
**URL:** https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259
**Category:** Technical Support
**Created:** [July 31, 2023, 10:25am UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259 "2023-07-31T10:25:41Z")
**Posts on this page:** 20
**Page:** 1
### Author:  [@D\_S](https://forum.qiime2.org/u/D_S)
#### Post date: [July 31, 2023, 10:25am UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/1 "2023-07-31T10:25:41Z")
[sample\_id.csv](https://forum.qiime2.org/uploads/short-url/fPFnygHZ9HNejd8DVmoLLMuLR3V.csv) (575 Bytes)
[cutadapt\_trimming.log.txt](https://forum.qiime2.org/uploads/short-url/bt6hyYXlabHKXllkcdXvnahwtVf.txt) (809 Bytes)
[env\_log.txt](https://forum.qiime2.org/uploads/short-url/ljHYfXx6kFzkCbbvmFPgbC5muzO.txt) (3.1 KB)
[list\_log.txt](https://forum.qiime2.org/uploads/short-url/tlol2tbdSuOiwB9XDxK0z9agLHc.txt) (48.3 KB)
[qiime\_info\_log.txt](https://forum.qiime2.org/uploads/short-url/gcZT58DrFHb3VEUc1gxLsNylPU.txt) (782 Bytes)
Hello Forum,
I am running qiime2 on a virtual machine (Hyper V manager, Windows 10 professional) and I am stuck at the step where I am trying to remove the primer and adaptor sequences from it (qiime2 cutadapt error-screenshot attached). I also generated a log.
[D\_S\_cutadapt.zip](https://forum.qiime2.org/uploads/short-url/bHG4sVnR52jHPTD9zHYt54O8FzQ.zip) (154.3 KB)
Processing: qiime2-cutadapt error screenshot.JPG...
[sample\_id.csv](https://forum.qiime2.org/uploads/short-url/fPFnygHZ9HNejd8DVmoLLMuLR3V.csv) (575 Bytes)
file for the command (cutadapt\_trimming.log - attached) which states "These commands cannot be manually re-run as they will depend on temporary files that no longer exist".
The input files are paired end in Fastq.gz file format (sample id file - attached).
I found a previous conversation where another user had a similar problem and tried to follow the suggested remedy for the situation but the thread was closed even before it was properly solved.
> [@Cutadapt script](https://forum.qiime2.org/t/cutadapt-script/15756):
>
> Hi everybody! I'm Giulia form Univeristy of Padua and I used to analzye my 16 S data with qiime2. In this week I tried to re-analyze my data and I have one problem when I run this command qiime cutadapt trim-paired --i-demultiplexed-sequences demux-paired-end\_I20.qza --p-front-f TCCTACGGGAGGCAGCAGT --p-front-r GGACTACCAGGGTATCTAATCCTGTT --o-trimmed-sequences cutadapt\_demux\_I20.qza I think the script is correct but i tried to run it on my old dataset (and this command worked) but in this moment…
I tried the suggested commands env (env\_log.txt - attached) and conda list (list\_log.txt -attached) and qiime info (qiime\_info\_log) but then i don't know how to proceed from there.
[D\_S\_cutadapt.zip](https://forum.qiime2.org/uploads/short-url/bHG4sVnR52jHPTD9zHYt54O8FzQ.zip) (154.3 KB)
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [July 31, 2023, 4:20pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/2 "2023-07-31T16:20:12Z")
Hi @D_S,
Welcome to the :qiime2: forum!
Thanks for providing all of these details - from the traceback you provided, it looks like the error is coming from this line:
```auto
ModuleNotFoundError: No module named 'cutadapt'
```
There is probably something fishy going on with your conda environment - can you please run the following command (while in your `qiime2-2022.11` environment), and copy/paste the results in your response:
```auto
qiime info
```
Thanks! 🦎
---
### Author:  [@D\_S](https://forum.qiime2.org/u/D_S)
#### Post date: [August 1, 2023, 7:22am UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/3 "2023-08-01T07:22:53Z")
Hi @lizgehret,
Thanks a lot for the response.
Here's the output for the command "qiime info" under the qiime2-2022.11 environment:
(qiime2-2022.11) mih@hvubuntusvr01:~/JR2\_qiime2$ qiime info
System versions
Python version: 3.8.15
QIIME 2 release: 2022.11
QIIME 2 version: 2022.11.1
q2cli version: 2022.11.1
Installed plugins
alignment: 2022.11.1
composition: 2022.11.2
cutadapt: 2022.11.1
dada2: 2022.11.2
deblur: 2022.11.1
demux: 2022.11.1
diversity: 2022.11.1
diversity-lib: 2022.11.1
emperor: 2022.11.1
feature-classifier: 2022.11.1
feature-table: 2022.11.1
fragment-insertion: 2022.11.1
gneiss: 2022.11.1
longitudinal: 2022.11.1
metadata: 2022.11.1
phylogeny: 2022.11.1
quality-control: 2022.11.1
quality-filter: 2022.11.1
rescript: 2023.2.0
sample-classifier: 2022.11.1
taxa: 2022.11.1
types: 2022.11.1
vsearch: 2022.11.1
Application config directory
/home/mih/anaconda3/envs/qiime2-2022.11/var/q2cli
Getting help
To get help with QIIME 2, visit [https://qiime2.org](https://qiime2.org)
Best,
D\_S
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 1, 2023, 3:45pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/4 "2023-08-01T15:45:35Z")
Hi @D_S,
That's interesting - you do have cutadapt under the list of qiime plugins within your environment. Can you also run `conda list` and provide that output as well? It might be fairly long, so feel free to include that output in a text file and attach it in your response. Thanks! 🦎
---
### Author:  [@D\_S](https://forum.qiime2.org/u/D_S)
#### Post date: [August 1, 2023, 4:26pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/5 "2023-08-01T16:26:02Z")
Hi @lizgehret,
Thanks again.
attached you can find the conda\_list.txt file.
Best,
D\_S
[list\_log.txt](https://forum.qiime2.org/uploads/short-url/tlol2tbdSuOiwB9XDxK0z9agLHc.txt) (48.3 KB)
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 1, 2023, 5:01pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/6 "2023-08-01T17:01:01Z")
Hi @D_S,
Thanks for sharing that! It looks like you have both the base cutadapt package, as well as q2-cutadapt (the QIIME 2 plugin that wraps cutadapt). Can you try running `qiime cutadapt --help` in your same conda environment, and share the output? Thanks! 🦎
---
### Author:  [@D\_S](https://forum.qiime2.org/u/D_S)
#### Post date: [August 1, 2023, 5:18pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/7 "2023-08-01T17:18:10Z")
Hi @lizgehret,
Here's the output after running the qiime cutadapt --help command:
Usage: qiime cutadapt [OPTIONS] COMMAND [ARGS]...
Description: This QIIME 2 plugin uses cutadapt to work with adapters (e.g.
barcodes, primers) in sequence data.
Plugin website: [GitHub - qiime2/q2-cutadapt](https://github.com/qiime2/q2-cutadapt)
Getting user support: Please post to the QIIME 2 forum for help with this
plugin: [https://forum.qiime2.org](https://forum.qiime2.org)
Options:
--version Show the version and exit.
--example-data PATH Write example data and exit.
--citations Show citations and exit.
--help Show this message and exit.
Commands:
demux-paired Demultiplex paired-end sequence data with barcodes in-
sequence.
demux-single Demultiplex single-end sequence data with barcodes in-
sequence.
trim-paired Find and remove adapters in demultiplexed paired-end
sequences.
trim-single Find and remove adapters in demultiplexed single-end
sequences.
Best,
D\_S
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 1, 2023, 5:35pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/8 "2023-08-01T17:35:12Z")
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 1, 2023, 5:53pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/9 "2023-08-01T17:53:12Z")
@D_S very interesting... Okay let's just try having you run your initial command once more (making sure to include the `--verbose` command) and see if we get the same error message as before.
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 1, 2023, 5:53pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/10 "2023-08-01T17:53:15Z")
---
### Author:  [@D\_S](https://forum.qiime2.org/u/D_S)
#### Post date: [August 1, 2023, 6:31pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/11 "2023-08-01T18:31:28Z")
Hi @lizgehret
yes, still getting the same error message as before.
Please check the jpeg for the screenshot and the log file for the error message.
Best,
D\_S
[cutadapt\_trimming1.log.txt](https://forum.qiime2.org/uploads/short-url/us2ccrgMfRnJ8bh1I1ukqIfYwg6.txt) (809 Bytes)
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 1, 2023, 6:35pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/12 "2023-08-01T18:35:31Z")
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 2, 2023, 3:43pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/13 "2023-08-02T15:43:33Z")
Hi @D_S,
Well, thanks for giving that a try! Let me try to replicate this issue on my end - do you mind sharing your `seqs.qza` file with me? DM is fine if you'd prefer not to share publicly on the forum.
Cheers 🦎
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 2, 2023, 3:43pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/14 "2023-08-02T15:43:36Z")
---
### Author:  [@D\_S](https://forum.qiime2.org/u/D_S)
#### Post date: [August 2, 2023, 6:23pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/15 "2023-08-02T18:23:27Z")
Hi @lizgehret,
Thank you for your continuous support. Unfortunately, the .qza file size exceeds the maximum size limit (7.9Mb) for sending it here. If you could provide me with an email address, I'd be grateful, and will send it over to you (around 59Mb in size).
Best regards,
D\_S
---
### Author:  [@D\_S](https://forum.qiime2.org/u/D_S)
#### Post date: [August 3, 2023, 11:38am UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/16 "2023-08-03T11:38:42Z")
Hi @lizgehret,
Please check the link below for downloading the file.
[https://www.dropbox.com/scl/fi/9fbcm6grby8kxl61aeg7o/seqs.qza?rlkey=nid6eunexksmxvrqjzlwty00v&dl=0](https://www.dropbox.com/scl/fi/9fbcm6grby8kxl61aeg7o/seqs.qza?rlkey=nid6eunexksmxvrqjzlwty00v&dl=0)
Thanks again,
D\_S
---
### Author:  [@cherman2](https://forum.qiime2.org/u/cherman2)
#### Post date: [August 3, 2023, 3:03pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/17 "2023-08-03T15:03:42Z")
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 3, 2023, 8:42pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/18 "2023-08-03T20:42:57Z")
Hi @D_S,
Thanks for sharing that file - I was able to run this successfully on my end. It seems like there's most likely an issue with your conda environment. Here's what I'd recommend - I would delete your 2022.11 environment (via `conda deactivate` and then `conda env remove -n qiime2-2022.11`, run `conda clean --all`, and then re-install a new QIIME 2 environment. You can either re-install [2022.11](https://docs.qiime2.org/2022.11/install/native/#install-qiime-2-within-a-conda-environment) (if you need that version to maintain consistency across your analysis) or you can install our latest version - [2023.5](https://docs.qiime2.org/2023.5/install/native/#install-qiime-2-within-a-conda-environment).
Cheers 🦎
---
### Author:  [@lizgehret](https://forum.qiime2.org/u/lizgehret)
#### Post date: [August 3, 2023, 8:43pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/19 "2023-08-03T20:43:00Z")
---
### Author:  [@D\_S](https://forum.qiime2.org/u/D_S)
#### Post date: [August 4, 2023, 4:16pm UTC](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259/20 "2023-08-04T16:16:56Z")
Hi @lizgehret
Thanks for your help.
I uninstalled the previous version (qiime2-2022.11) and checked and removed any other discoverable environments with "conda info --envs" and "conda env remove ..." commands.
Installed the latest version and everything seemed fine until the cutadapt command and it resulted in a similar error as before: please check the .jpeg (verbose)
[cutadapt\_trimminglog.txt](https://forum.qiime2.org/uploads/short-url/qUxYs2NrArVODOWx5ZhmG0xKuWq.txt) (808 Bytes)
and log.txt files for details
Best,
D\_S
[Next page](https://forum.qiime2.org/t/cutadapt-in-qiime2-2022-11/27259.md?page=2)