# Any method for converting FASTA to taxonomy (txt) format for import to FeatureData\[Taxonomy\]?

**URL:** https://forum.qiime2.org/t/any-method-for-converting-fasta-to-taxonomy-txt-format-for-import-to-featuredata-taxonomy/9960
**Category:** General Discussion
**Tags:** feature-classifier, taxonomy, import
**Created:** [May 27, 2019, 8:18am UTC](https://forum.qiime2.org/t/any-method-for-converting-fasta-to-taxonomy-txt-format-for-import-to-featuredata-taxonomy/9960 "2019-05-27T08:18:14Z")
**Posts on this page:** 1
**Showing post:** 2

<div class="post-metadata">

### Author: ![Nicholas\_Bokulich](https://forum.qiime2.org/user_avatar/forum.qiime2.org/nicholas_bokulich/32/19937_2.png) [@Nicholas\_Bokulich](https://forum.qiime2.org/u/Nicholas_Bokulich)
#### Post date: [May 27, 2019, 1:04pm UTC](https://forum.qiime2.org/t/any-method-for-converting-fasta-to-taxonomy-txt-format-for-import-to-featuredata-taxonomy/9960/2 "2019-05-27T13:04:30Z")

</div>

> [@ojholland](#):
>
> Unfortunately, unlike the 16S region, there are no databases (that I know of) that are specific to the gene region I am targeting.

Check out the SILVA database — in addition to the SSU database that is most commonly used, they have a LSU database, which would include 23S. What I do not know is if it is comprehensive enough for your purposes (e.g., has all the species you expect to see). I'd start there — building on an existing database is always much easier than building a new one from scratch!

> [@ojholland](#):
>
> Is there a way to convert an aligned FASTA file of multiple sequences from a blast search to a complementary txt file in the format above to be used in creating a custom database?

what do the header lines look like in that fasta? If it is something like:

```auto
>sequenceID| d_Eukaryota;k_Chromista;p_Ochrophyta;c_Phaeophyceae;o_Fucales;f_Hormosiraceae;g_Hormosira;s_Hormosira_banksii
ACGTGTAGTGTGCTGTAGTAGTCGTGAC

```

then you can easily do this with some bash commands. Something like this:

```auto
grep '>' pathto.fasta | tr -d '>' | tr '|' '\t'

```

But if the full taxonomy string is not in the header line of the fasta then that will not help.

---

_[View the full topic](https://forum.qiime2.org/t/any-method-for-converting-fasta-to-taxonomy-txt-format-for-import-to-featuredata-taxonomy/9960)._