after mutiplexepairedEndBarcodeInsequence import

[chivaleris (TU JIAJIE)]

Hello everyone, I am really new in Qiime2.
I have some stupid questions in importing data. Now I only have paired-end row data from illumina miseq. The format like this:

@MISEQ04:230:000000000-BLP2G:1:1101:12118:1920 1:N:0:TACATGTC
CTAGTAGGACCCTACGGGTGGCAGCAGTGGGGAATTTTTCGCAATTCTCTTTAGATTTACGCATCTACTCC
+
CCCCCGFAGGF@EGE777F:+C@,@86F,,C+,,CCEE,;+,,+8,<;@,,,,,,,<,,9,6,,6,,<,99,9,C,,,<,,6,,,,,99CF=,,,:C,C,,,,<C5
according to sequencing report, I realize in my raw data there exist single barcode(e.g. CTATAC) and primer sequence. I use mutiplexepairedEndBarcodeInsequence successfully imported my data and got an mutiplexed-seqs.qza. Then I want to use cutadapt to separate the samples sequences. Here is my code:
qiime cutadapt demux-paired \

--i-seqs multiplexed-paired-seqs.qza
--m-forward-barcodes-file metadata.tsv.xlsx
--m-forward-barcodes-column SequenceBarcode
--o-per-sample-sequences demultiplexed-seqs.qza
--o-untrimmed-sequences untrimmed.qza

but I got an error:
Error: Invalid value for "--i-seqs": File "multiplexed-paired-seqs.qza" does not exist.
I can't figure out the reason. What can I do ?

[Mehrbod_Estaki]

Hi @chivaleris,
This error simply indicates that there is no file named multiplexed-paired-seqs.qza in the current directory you are running the script from. Check the spellings, and make sure the file is indeed in the directory you are in, if it’s not you want to make sure you give the right path into your- --i-seqs line.