# General Discussion **URL:** https://forum.qiime2.org/c/general-discussion/23.md?page=2 [Latest](https://forum.qiime2.org/latest.md) · [Categories](https://forum.qiime2.org/categories.md) · [Tags](https://forum.qiime2.org/tags.md) **Page:** 3 --- ## [Alpha and Beta Diversity analysis using shotgun metagenomics data](https://forum.qiime2.org/t/alpha-and-beta-diversity-analysis-using-shotgun-metagenomics-data/33930)
**Author:** [@Synapse](https://forum.qiime2.org/u/Synapse)\ **Replies:** 2\ **Last updated:** [January 26, 2026, 7:48am UTC](https://forum.qiime2.org/t/alpha-and-beta-diversity-analysis-using-shotgun-metagenomics-data/33930 "2026-01-26T07:48:06Z")
Dear all, Good day QIIME community! I am new to QIIME2 and would appreciate some guidance. We are working on a project involving a biofilm, and we plan to send our samples to a facility for shotgun metagenomic sequenci… --- ## [Comparing 16S and shotgun metagenomic data with greengenes2](https://forum.qiime2.org/t/comparing-16s-and-shotgun-metagenomic-data-with-greengenes2/33895)
**Author:** [@Bark9299](https://forum.qiime2.org/u/Bark9299)\ **Replies:** 3\ **Last updated:** [January 20, 2026, 9:51pm UTC](https://forum.qiime2.org/t/comparing-16s-and-shotgun-metagenomic-data-with-greengenes2/33895 "2026-01-20T21:51:58Z")
Hello, I have both 16S rRNA V4 and shotgun metagenomic data from the same samples and I want to broadly compare overall patterns in alpha and beta diversity by treatment, and in seeing whether 16S and shotgun data recov… --- ## [bivalve gut microbiota, water and soil samples What OTU cluster?](https://forum.qiime2.org/t/bivalve-gut-microbiota-water-and-soil-samples-what-otu-cluster/33894)
**Author:** [@Katerina\_Fialova](https://forum.qiime2.org/u/Katerina_Fialova)\ **Replies:** 11\ **Last updated:** [January 19, 2026, 5:05pm UTC](https://forum.qiime2.org/t/bivalve-gut-microbiota-water-and-soil-samples-what-otu-cluster/33894 "2026-01-19T17:05:10Z")
Hi, my name is Kejty, and I am still a newbie in the world of bioinformatics. I am studying gut microbiota from bivalves, along with water and soil microbiomes. My samples were sequenced on Illumina, targeting the V3–V4… --- ## [Advice in best practice for handling multiple sequencing runs and subset analyses in QIIME 2 (DADA2)](https://forum.qiime2.org/t/advice-in-best-practice-for-handling-multiple-sequencing-runs-and-subset-analyses-in-qiime-2-dada2/33913)
**Author:** [@ppm](https://forum.qiime2.org/u/ppm)\ **Replies:** 2\ **Last updated:** [January 16, 2026, 8:55am UTC](https://forum.qiime2.org/t/advice-in-best-practice-for-handling-multiple-sequencing-runs-and-subset-analyses-in-qiime-2-dada2/33913 "2026-01-16T08:55:26Z")
I would appreciate some advice on the best workflow for my analysis. I have two sets of samples generated from two different sequencing runs. Both runs are 16S rRNA gene amplicons (V3–V4 region, 2×300 bp). One run contai… --- ## [Quickstart not working in Safari, but works on Chrome](https://forum.qiime2.org/t/quickstart-not-working-in-safari-but-works-on-chrome/33904)
**Author:** [@tsimmons.ag](https://forum.qiime2.org/u/tsimmons.ag)\ **Replies:** 4\ **Last updated:** [January 14, 2026, 2:55pm UTC](https://forum.qiime2.org/t/quickstart-not-working-in-safari-but-works-on-chrome/33904 "2026-01-14T14:55:50Z")
Posting this here in case someone else comes looking for a solution. The Quickstart page yields an error message when opening on Safari, but everything shows up just fine in Chrome. Don’t waste time looking for another p… --- ## [Seeking advice for a Thesis project](https://forum.qiime2.org/t/seeking-advice-for-a-thesis-project/33881)
**Author:** [@nara](https://forum.qiime2.org/u/nara)\ **Replies:** 3\ **Last updated:** [January 12, 2026, 1:20pm UTC](https://forum.qiime2.org/t/seeking-advice-for-a-thesis-project/33881 "2026-01-12T13:20:29Z")
Hi everyone, I am currently an undergraduate Data Science student looking for advice on structuring a workflow for my upcoming thesis. My Background: I have successfully completed the standard QIIME 2 tutorials (like M… --- ## [How to deal with possible cross-contamination by a crucial bacteria](https://forum.qiime2.org/t/how-to-deal-with-possible-cross-contamination-by-a-crucial-bacteria/33889)
**Author:** [@joaomiranda](https://forum.qiime2.org/u/joaomiranda)\ **Replies:** 1\ **Last updated:** [January 8, 2026, 11:21am UTC](https://forum.qiime2.org/t/how-to-deal-with-possible-cross-contamination-by-a-crucial-bacteria/33889 "2026-01-08T11:21:43Z")
Hi everyone, happy new year! I'm dealing with a difficult issue, so I need your help to proceed on the right path. I'm using qiime2-amplicon-2025.10, I have a 16S dataset of 2 runs with 175 samples. I'm analyzing micr… --- ## [Diversity analysis interpretation](https://forum.qiime2.org/t/diversity-analysis-interpretation/33869)
**Author:** [@asmaamorsi](https://forum.qiime2.org/u/asmaamorsi)\ **Replies:** 1\ **Last updated:** [December 17, 2025, 12:28am UTC](https://forum.qiime2.org/t/diversity-analysis-interpretation/33869 "2025-12-17T00:28:03Z")
Hi everyone, Can someone help me to interpret the Shannon alpha diversity output? Is the H value a measure of sample richness only? And does the p-value represent the significant differences between samples based on H … --- ## [Remove Unassigned ASV for Tree construction](https://forum.qiime2.org/t/remove-unassigned-asv-for-tree-construction/33866)
**Author:** [@Alessandro](https://forum.qiime2.org/u/Alessandro)\ **Replies:** 3\ **Last updated:** [December 16, 2025, 2:43pm UTC](https://forum.qiime2.org/t/remove-unassigned-asv-for-tree-construction/33866 "2025-12-16T14:43:33Z")
Hi everyone, I don’t have much experience with statistical and phylogenetic analyses, and I have only recently started using QIIME 2. By following the suggested tutorials, I reached the step of building a phylogenetic tr… --- ## [Seeking alternatives to rarefaction for Alpha diversity analysis](https://forum.qiime2.org/t/seeking-alternatives-to-rarefaction-for-alpha-diversity-analysis/33836)
**Author:** [@asmaamorsi](https://forum.qiime2.org/u/asmaamorsi)\ **Replies:** 8\ **Last updated:** [December 11, 2025, 3:20pm UTC](https://forum.qiime2.org/t/seeking-alternatives-to-rarefaction-for-alpha-diversity-analysis/33836 "2025-12-11T15:20:33Z")
Dear all, I have several samples with very different sampling depths. During the rarefaction step I would either lose about 25% of my samples or I would need to use a sampling depth of 1000 to retain roughly 90% of them.… --- ## [Guidance on Merging and Handling Samples from Multiple Sequencing Runs](https://forum.qiime2.org/t/guidance-on-merging-and-handling-samples-from-multiple-sequencing-runs/32024)
**Author:** [@Sabrin](https://forum.qiime2.org/u/Sabrin)\ **Replies:** 5\ **Last updated:** [December 2, 2025, 5:53am UTC](https://forum.qiime2.org/t/guidance-on-merging-and-handling-samples-from-multiple-sequencing-runs/32024 "2025-12-02T05:53:12Z")
Dear QIIME Community, Thank you for the great forum and the valuable discussions! I’ve searched extensively but couldn’t find definitive answers to some questions about my dataset. I’d greatly appreciate your guidance. … --- ## [Lost files - rep-seq already filtered, need combined](https://forum.qiime2.org/t/lost-files-rep-seq-already-filtered-need-combined/33820)
**Author:** [@rward1](https://forum.qiime2.org/u/rward1)\ **Replies:** 1\ **Last updated:** [November 25, 2025, 8:28am UTC](https://forum.qiime2.org/t/lost-files-rep-seq-already-filtered-need-combined/33820 "2025-11-25T08:28:06Z")
We lost some files after a computer died. We want to do a permanova on some beta diversity data. We have meta-data filtered table.qza files left but not the aggregate. Is there a fast way to recombine the data? If w… --- ## [priors in qiime2-dada2](https://forum.qiime2.org/t/priors-in-qiime2-dada2/26221)
**Author:** [@Alberto\_Pascale](https://forum.qiime2.org/u/Alberto_Pascale)\ **Replies:** 3\ **Last updated:** [April 25, 2023, 12:58pm UTC](https://forum.qiime2.org/t/priors-in-qiime2-dada2/26221 "2023-04-25T12:58:34Z")
Hi, is there an option in the dada2 plugin under qiime2 for "priors" specific sequences as reported in the dada2 tutorial for pseudo-pooling? --- ## [How to find the genus level from bacteria with from 16s method](https://forum.qiime2.org/t/how-to-find-the-genus-level-from-bacteria-with-from-16s-method/33791)
**Author:** [@iordanis](https://forum.qiime2.org/u/iordanis)\ **Replies:** 4\ **Last updated:** [November 18, 2025, 10:32am UTC](https://forum.qiime2.org/t/how-to-find-the-genus-level-from-bacteria-with-from-16s-method/33791 "2025-11-18T10:32:14Z")
Hello everyone, I have performed a 16S rRNA differential-abundance meta-analysis, and some taxa in my results are not at the genus level but only at the family or order level. Does anyone know of any tools or methods th… --- ## [Phylogenetic tree: Reconstruct vs. Prune - When to?](https://forum.qiime2.org/t/phylogenetic-tree-reconstruct-vs-prune-when-to/33753)
**Author:** [@AviTil](https://forum.qiime2.org/u/AviTil)\ **Replies:** 6\ **Last updated:** [November 15, 2025, 6:57am UTC](https://forum.qiime2.org/t/phylogenetic-tree-reconstruct-vs-prune-when-to/33753 "2025-11-15T06:57:54Z")
Hi, This is a relatively simple question. When does one choose to reconstruct a tree vs. prune a phylogenetic tree? Are constructed trees comparable? Say I perform a meta-analysis, and I have a large collection of stu… --- ## [DADA2 -- denoise](https://forum.qiime2.org/t/dada2-denoise/33767)
**Author:** [@karitorikin](https://forum.qiime2.org/u/karitorikin)\ **Replies:** 2\ **Last updated:** [November 7, 2025, 7:13am UTC](https://forum.qiime2.org/t/dada2-denoise/33767 "2025-11-07T07:13:55Z")
hi, below you can find my demux.qzv showing the read quality before DADA2 denoising, I cannot adjust my truncation values properly. I am replicating one of the studies done before and I know the OTU count that they had, … --- ## [MOSHPIT: removing contaminant reads from metagenome data](https://forum.qiime2.org/t/moshpit-removing-contaminant-reads-from-metagenome-data/33456)
**Author:** [@charlesalexandreroy](https://forum.qiime2.org/u/charlesalexandreroy)\ **Replies:** 11\ **Last updated:** [August 18, 2025, 8:24pm UTC](https://forum.qiime2.org/t/moshpit-removing-contaminant-reads-from-metagenome-data/33456 "2025-08-18T20:24:02Z")
I have some similar questions for anyone who can provide additional insight. I've been following the MOSHPIT tutorial for performing shotgun metagenomic data analysis. The QC section titled "Host read removal" seems to … --- ## [code “E.AniM” in KO](https://forum.qiime2.org/t/code-e-anim-in-ko/33745)
**Author:** [@timanix](https://forum.qiime2.org/u/timanix)\ **Replies:** 2\ **Last updated:** [November 3, 2025, 11:31am UTC](https://forum.qiime2.org/t/code-e-anim-in-ko/33745 "2025-11-03T11:31:48Z")
Dear all, Currently, I am struggling :thinking: with the right strategy for performing analyses related to the functional annotations (KEGGs). Among the KEGGs I am getting, some are not related to the bacteria (code “… --- ## [Filtering all Metazoa and bacteria out of my sample](https://forum.qiime2.org/t/filtering-all-metazoa-and-bacteria-out-of-my-sample/33735)
**Author:** [@zu\_mu](https://forum.qiime2.org/u/zu_mu)\ **Replies:** 1\ **Last updated:** [October 23, 2025, 2:14am UTC](https://forum.qiime2.org/t/filtering-all-metazoa-and-bacteria-out-of-my-sample/33735 "2025-10-23T02:14:53Z")
Here is my code: qiime taxa filter-seqs \\ --i-sequences rep-seqs.qza \\ --i-taxonomy taxonomy.qza \\ --p-exclude d\_\_Bacteria, p\_\_Arthropoda, p\_\_Annelida, p\_\_Thermoplasmatota, p\_\_Incertae\_Sedis, Unassigned, p\_\_… --- ## [PERMANOVA results significant, but differential abundance results detect 0 significantly different ASVs](https://forum.qiime2.org/t/permanova-results-significant-but-differential-abundance-results-detect-0-significantly-different-asvs/33730)
**Author:** [@PabloCL](https://forum.qiime2.org/u/PabloCL)\ **Replies:** 3\ **Last updated:** [October 20, 2025, 11:57am UTC](https://forum.qiime2.org/t/permanova-results-significant-but-differential-abundance-results-detect-0-significantly-different-asvs/33730 "2025-10-20T11:57:59Z")
Hello, I am performing a study about differences in microbial communities between two sample types in an Antarctic ecosystem. According to PERMANOVA, there are significant differences between communities of the two samp… --- ## [Interpreting KEGG vs MetaCyc pathways in 16S (PICRUSt2) functional prediction](https://forum.qiime2.org/t/interpreting-kegg-vs-metacyc-pathways-in-16s-picrust2-functional-prediction/33729)
**Author:** [@Tharindu](https://forum.qiime2.org/u/Tharindu)\ **Replies:** 1\ **Last updated:** [October 18, 2025, 5:07am UTC](https://forum.qiime2.org/t/interpreting-kegg-vs-metacyc-pathways-in-16s-picrust2-functional-prediction/33729 "2025-10-18T05:07:04Z")
Interpreting KEGG vs MetaCyc pathways Hi everyone, I’m new to QIIME 2 and still learning about functional prediction. I have a theoretical question about how to interpret MetaCyc and KEGG pathway outputs from PICRUSt2. … --- ## [Converting 16S V3–V4 ASV reads to absolute copy numbers (qPCR / spike-in calibration?)](https://forum.qiime2.org/t/converting-16s-v3-v4-asv-reads-to-absolute-copy-numbers-qpcr-spike-in-calibration/33705)
**Author:** [@Rainjie](https://forum.qiime2.org/u/Rainjie)\ **Replies:** 3\ **Last updated:** [October 9, 2025, 6:13pm UTC](https://forum.qiime2.org/t/converting-16s-v3-v4-asv-reads-to-absolute-copy-numbers-qpcr-spike-in-calibration/33705 "2025-10-09T18:13:19Z")
Hi, good day Qiime2 team. I’m working with 16S rRNA V3–V4 amplicons from bacterial strains using universal primers. After processing the raw .fastq.gz files with DADA2 in QIIME 2, I have an ASV table (samples × ASVs, re… --- ## [How to test for dissimilarity for my samples](https://forum.qiime2.org/t/how-to-test-for-dissimilarity-for-my-samples/24968)
**Author:** [@mradz](https://forum.qiime2.org/u/mradz)\ **Replies:** 1\ **Last updated:** [December 22, 2022, 10:20am UTC](https://forum.qiime2.org/t/how-to-test-for-dissimilarity-for-my-samples/24968 "2022-12-22T10:20:19Z")
I am working on a project where I want to look at differences in the microbiome following drug treatment based on several clincial variables. For example, I have stool samples for pre and post drug treatment for a serie… --- ## [Rareifying ASV reads for Alpha and Beta diversity analysis](https://forum.qiime2.org/t/rareifying-asv-reads-for-alpha-and-beta-diversity-analysis/33680)
**Author:** [@Mahima\_y](https://forum.qiime2.org/u/Mahima_y)\ **Replies:** 1\ **Last updated:** [September 26, 2025, 6:02am UTC](https://forum.qiime2.org/t/rareifying-asv-reads-for-alpha-and-beta-diversity-analysis/33680 "2025-09-26T06:02:02Z")
Hello! I am running an alpha and beta diversity analysis of my ASV data. I rarefied my ASV data to the same read depth for Shannon Diversity Analysis, but I was wondering if I should use my rareified data for richness an… --- ## [Ancom-BC2 analysis along time series](https://forum.qiime2.org/t/ancom-bc2-analysis-along-time-series/33671)
**Author:** [@arwqiime](https://forum.qiime2.org/u/arwqiime)\ **Replies:** 4\ **Last updated:** [September 24, 2025, 6:38am UTC](https://forum.qiime2.org/t/ancom-bc2-analysis-along-time-series/33671 "2025-09-24T06:38:40Z")
Hello, I was searching for an explanation/tutorial of the ancombc2 command that would help me to analyze differentially abundant ASVs along a time series of experiments. It seems that ancombc2 has not (yet) been include… --- ## [Training a classifer for 18S and CO1 edna](https://forum.qiime2.org/t/training-a-classifer-for-18s-and-co1-edna/33667)
**Author:** [@zu\_mu](https://forum.qiime2.org/u/zu_mu)\ **Replies:** 2\ **Last updated:** [September 21, 2025, 5:19am UTC](https://forum.qiime2.org/t/training-a-classifer-for-18s-and-co1-edna/33667 "2025-09-21T05:19:46Z")
Hello I’m using the v9 18S primers so F and R are: 1391F: AATGATACGGCGACCACCGAGATCTACAC TATCGCCGTT CG GTACACACCGCCCGTC EukBR: CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXXXX AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC This is a gene… --- ## [Axis value percentages have no meaning in PCoA ?](https://forum.qiime2.org/t/axis-value-percentages-have-no-meaning-in-pcoa/33666)
**Author:** [@Chathuranga\_De\_Silva](https://forum.qiime2.org/u/Chathuranga_De_Silva)\ **Replies:** 5\ **Last updated:** [September 20, 2025, 11:50pm UTC](https://forum.qiime2.org/t/axis-value-percentages-have-no-meaning-in-pcoa/33666 "2025-09-20T23:50:34Z")
In one of the thesis defense seminars, one of the professors argued that the statement “Principal Coordinates Analysis (PCoA) of bray Curtis distances showed that the first two principal coordinates were able to explain … --- ## [Why is non-chimera read count often referred to as sequencing depth in 16S rRNA analysis?](https://forum.qiime2.org/t/why-is-non-chimera-read-count-often-referred-to-as-sequencing-depth-in-16s-rrna-analysis/33650)
**Author:** [@gy.park](https://forum.qiime2.org/u/gy.park)\ **Replies:** 4\ **Last updated:** [September 18, 2025, 1:15am UTC](https://forum.qiime2.org/t/why-is-non-chimera-read-count-often-referred-to-as-sequencing-depth-in-16s-rrna-analysis/33650 "2025-09-18T01:15:20Z")
Hello, I have a question regarding the definition of sequencing depth in 16S rRNA amplicon sequencing workflows. In whole-genome or shotgun metagenomics, sequencing depth (coverage) is usually defined as: Depth=Total b… --- ## [Percentage of reads discarded after running DADA2 on NextSeq data](https://forum.qiime2.org/t/percentage-of-reads-discarded-after-running-dada2-on-nextseq-data/33618)
**Author:** [@rachelmugge](https://forum.qiime2.org/u/rachelmugge)\ **Replies:** 1\ **Last updated:** [August 25, 2025, 6:35pm UTC](https://forum.qiime2.org/t/percentage-of-reads-discarded-after-running-dada2-on-nextseq-data/33618 "2025-08-25T18:35:33Z")
Hello! I have recently switched from analyzing MiSeq data, which I’m more familiar with, to NextSeq data, and I’m curious about the percentage of reads discarded after running NextSeq data through the DADA2 pipeline. F… --- ## [Batch effects - Normalizing sequencing runs with different sequence counts](https://forum.qiime2.org/t/batch-effects-normalizing-sequencing-runs-with-different-sequence-counts/33609)
**Author:** [@Diego\_Yusta](https://forum.qiime2.org/u/Diego_Yusta)\ **Replies:** 3\ **Last updated:** [August 20, 2025, 8:51pm UTC](https://forum.qiime2.org/t/batch-effects-normalizing-sequencing-runs-with-different-sequence-counts/33609 "2025-08-20T20:51:34Z")
Hi all, This is my first time posting but these forums have been an immense help with my sequencing analysis. For context, I am working with two sets of sequences from soil DNA extractions taken at two time points. Bot… [Previous page](https://forum.qiime2.org/c/general-discussion/23.md?page=1) [Next page](https://forum.qiime2.org/c/general-discussion/23.md?page=3)